ID: 906621087

View in Genome Browser
Species Human (GRCh38)
Location 1:47280085-47280107
Sequence TCTAGGCCCTCTTGTTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906621087_906621088 -8 Left 906621087 1:47280085-47280107 CCTGTAAAACAAGAGGGCCTAGA 0: 1
1: 0
2: 0
3: 11
4: 102
Right 906621088 1:47280100-47280122 GGCCTAGAATTCAGTTTCCAAGG 0: 1
1: 0
2: 2
3: 44
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906621087 Original CRISPR TCTAGGCCCTCTTGTTTTAC AGG (reversed) Intronic
900702332 1:4055977-4055999 TCTAGCCCCTCTTCTTATAAGGG - Intergenic
901718307 1:11174730-11174752 GCGAGGAACTCTTGTTTTACGGG + Intronic
902571763 1:17351809-17351831 TCCAGGCCCTCTTGCTGTTCTGG - Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
906621087 1:47280085-47280107 TCTAGGCCCTCTTGTTTTACAGG - Intronic
907564660 1:55423712-55423734 TCTGGGCTCCCTTGTTTTCCAGG - Intergenic
918233525 1:182557193-182557215 TCTAGGCCTTCCTGTCTTGCTGG - Intronic
919232824 1:194797260-194797282 TCTTGGCCCTTTTCTATTACTGG - Intergenic
924353925 1:243149527-243149549 TCTAGGCCCTGTTATTTTGTTGG - Intronic
1077494480 11:2880254-2880276 CCTAGCCCCTCCTGTTTTAAAGG + Intergenic
1080241529 11:30132719-30132741 TCTACTCCCTCTTATTTTTCAGG - Intergenic
1080654672 11:34249490-34249512 TCTAGGCCCTATTGTACTAGAGG - Intronic
1081977961 11:47247791-47247813 TTTAGGCCCTGTTGCTTTCCAGG + Intronic
1087002466 11:93434680-93434702 TTTAGGCTCTGTTGTTCTACAGG - Intronic
1087486542 11:98764489-98764511 TCTAGGCCCCCATGTTTGATGGG + Intergenic
1089428999 11:118405182-118405204 TCTAGGTCCTCTCATTTGACAGG + Intronic
1091224455 11:133949256-133949278 TCCAAGCCCTCTTGCTTTTCTGG + Intronic
1093800564 12:23367050-23367072 TCTAGGCACTTTTGTTTTCATGG + Intergenic
1096812783 12:54182398-54182420 TCTATGCCCTCTGCTTTTCCTGG - Exonic
1098420871 12:70296178-70296200 TATAGGCCATCTTGTTTTATTGG + Intronic
1101079351 12:101166699-101166721 TAAAGGCATTCTTGTTTTACAGG - Exonic
1102229163 12:111250407-111250429 CCTGGGTCCTCTTGTTTTAGAGG - Intronic
1102785598 12:115601758-115601780 TCTAGGCACTGTGGTTTCACTGG - Intergenic
1111419734 13:87997398-87997420 TTAAGGACCTCTTGTTATACAGG + Intergenic
1111475200 13:88737213-88737235 TCTAGCACCTCTTTTTTTAAAGG - Intergenic
1113255807 13:108503781-108503803 TCTAGCTCCTCATGTTTTAAAGG - Intergenic
1118596817 14:67441986-67442008 TATAGGCCCTCTACTTTTAGGGG + Intergenic
1120221583 14:81740440-81740462 TTTAGGCCCTCTTCTTTTATTGG - Intergenic
1122306787 14:100771526-100771548 TCTAGCACCTCTTGCTTTTCAGG + Intergenic
1122814592 14:104306295-104306317 TCCAGGCCCTCTTCTGTTTCAGG - Intergenic
1124718548 15:32091404-32091426 TCTGGGTCCTCAAGTTTTACTGG + Intronic
1126170215 15:45689336-45689358 TCTAGGCCCTCTTTTGCTGCTGG + Intronic
1131574612 15:93574377-93574399 TCTGGCCCAACTTGTTTTACTGG - Intergenic
1132364472 15:101247171-101247193 TCTTGGGGCTCTTCTTTTACTGG + Intronic
1137875219 16:51990166-51990188 TCTAGGCACACATGTTTTGCTGG + Intergenic
1139925248 16:70482412-70482434 TCTTGGATCTCTTGTTCTACAGG + Intronic
1143883755 17:10050831-10050853 TCCAGGCCCCCTTGTTTGAATGG - Intronic
1143938800 17:10516347-10516369 TCTGGCCTCTCTTGTTTGACTGG - Intronic
1144630950 17:16872212-16872234 TCTAGGCCCTCTACCTTTACTGG + Intergenic
1144650364 17:17003264-17003286 TCTAGGCCCTCTACCTTCACTGG - Intergenic
1157637049 18:49168989-49169011 TTTGGCCCCTCTTGTCTTACCGG - Intronic
1158701703 18:59754319-59754341 TCTTGGCCCTGTGCTTTTACTGG - Intergenic
1165102436 19:33446883-33446905 TCTAGCCCCTCTTATCTTGCTGG + Intronic
926625574 2:15086794-15086816 TCTAGGCACTCCTTTGTTACAGG - Intergenic
929978938 2:46661140-46661162 TCTAGGCTCTCTTATTCCACTGG + Intergenic
931088613 2:58862234-58862256 TTTTGGCCCTTCTGTTTTACTGG - Intergenic
934065012 2:88332382-88332404 TCTAGGCCCTGATTTTTTACTGG + Intergenic
934732515 2:96668553-96668575 TTTAGGGCCTCTTGTTTTCTGGG - Intergenic
935846603 2:107172607-107172629 TCCAGGCCCTCTTGACTGACAGG + Intergenic
938155427 2:128934931-128934953 TCTGGGCTCTCTTGTTTTATTGG + Intergenic
938560137 2:132464970-132464992 GCTAGGACCTCTTGGTTTAAGGG - Intronic
943122206 2:183750378-183750400 GCTAGCCTCTCTTGATTTACTGG + Intergenic
946171526 2:217898678-217898700 TCTGTGCCCTCTTGTTTTCTGGG - Intronic
947554626 2:231080595-231080617 TCTAGGCCCTAACATTTTACTGG + Intronic
948120493 2:235526305-235526327 TCTAGGTTCTCTTGATTGACAGG + Intronic
948400601 2:237682174-237682196 TCTAGAGCCCCTTGTTTTGCGGG + Intronic
948707636 2:239804920-239804942 ACTCAGCCCTTTTGTTTTACAGG - Intergenic
1169075577 20:2758074-2758096 TCCAGCCCTCCTTGTTTTACTGG - Intronic
1174294225 20:49533176-49533198 TCTAGGCCCTCTAGATTTGGGGG + Intronic
1177868091 21:26536953-26536975 TCTTGGCCCTTTTGTTTGACTGG - Intronic
1178855912 21:36250321-36250343 ACCAGGCTCTCTTGCTTTACCGG + Intronic
1183799705 22:40152001-40152023 TCTAGAATCTCTTGTTTTTCAGG - Intronic
953820262 3:46202271-46202293 TCTAAGCCTTCTGGTTTTATGGG - Exonic
959565181 3:107826228-107826250 TCTGGGCCCTATTGATTGACAGG - Intergenic
962681027 3:137800620-137800642 TCTAGCCCTTCTTGTCTTCCTGG - Intergenic
962704943 3:138033963-138033985 CATTGGCTCTCTTGTTTTACTGG - Intergenic
965635930 3:170780582-170780604 TGGAGGCCCTCTCATTTTACTGG + Intronic
966475234 3:180336969-180336991 CCTAGGCACTCTTGCTTTAGAGG - Intergenic
969073981 4:4562416-4562438 TCTAGGTCTTCTTGGTTAACAGG - Intergenic
972761996 4:42115467-42115489 ACTAGCCCTTCTTGTTTTTCTGG - Exonic
974478146 4:62409836-62409858 TCTAGGCCCTGCTGCTTAACAGG - Intergenic
976868560 4:89762018-89762040 TCTAGGCCCCTGTGATTTACTGG + Intronic
979247879 4:118530104-118530126 TCTAGGCCCTGTTATTTTGTTGG + Intergenic
980256278 4:130383821-130383843 TTTAGGCACTCTTGTTTAAGGGG - Intergenic
981263042 4:142745657-142745679 TGTAGGCACTCTTATTATACAGG - Intronic
983795737 4:171860391-171860413 TCTAGGTCCTATTATTTTACTGG - Intronic
986213701 5:5698544-5698566 TCTAGGCCCTCCTGCTTCATGGG + Intergenic
988078344 5:26382349-26382371 CCTGGGCCCTGTTGTTCTACAGG - Intergenic
993468124 5:88272480-88272502 TCTAGGGTCTCTTGTTGTAAAGG - Intergenic
1002886550 6:1301460-1301482 TATAGGCACTCTAGTTTTAGAGG - Intergenic
1005752616 6:28897200-28897222 TCTAGGGGCTCTTGTTCTAGTGG - Intergenic
1006203252 6:32316016-32316038 TAAAGGCCCTCTTCATTTACTGG + Intronic
1007661889 6:43491928-43491950 TCCAGGCCCTTTTGCTTTCCTGG - Intronic
1008222658 6:48874620-48874642 TCGTGGCCCTCTTGTTGTGCTGG - Intergenic
1008869200 6:56252020-56252042 TTTAAGCCATCTTGTTTTGCAGG + Intronic
1012310031 6:97712336-97712358 ACTCGGCCCTATTGTTTTACAGG - Intergenic
1012554063 6:100490744-100490766 TCTCGGCCTTCTTGTTCTAGTGG + Intergenic
1016071989 6:139749958-139749980 TATATTCCCCCTTGTTTTACAGG - Intergenic
1018056967 6:160060525-160060547 TCTGGGCCTTCTTGCTTTACAGG + Exonic
1018380370 6:163253535-163253557 TCTAAACCTTCTTATTTTACAGG + Intronic
1019758089 7:2788170-2788192 TCTTGGCTCTCTGGTTTTGCTGG - Intronic
1022259162 7:28687568-28687590 TGTTTGCCCTCTTGTTTTAGTGG - Intronic
1023808373 7:43891265-43891287 CCTATGCCATCTTGTTTTATGGG - Intronic
1028124166 7:87092494-87092516 TCTAGGCACTGTTGTTTACCAGG - Intergenic
1028277676 7:88877473-88877495 TCCAGTCCCTCTTATTTTAGGGG + Intronic
1037315763 8:17597792-17597814 TAGAGACCATCTTGTTTTACAGG - Intronic
1038300815 8:26345830-26345852 TCTATGCCCTCTTTTTCTAGTGG + Intronic
1045344556 8:101282555-101282577 TAGAGGCCAGCTTGTTTTACTGG - Intergenic
1045418377 8:101989814-101989836 CCTAGGCCCTCTCGTTCTCCTGG + Intronic
1046849898 8:118960300-118960322 TCCAGGTGCTATTGTTTTACGGG + Intergenic
1047419845 8:124698364-124698386 TCTGGGTCTTCTTGTTGTACTGG - Intronic
1059508117 9:114818522-114818544 TCTCAGCCCTCTTGTTTTCCTGG - Intergenic
1060300630 9:122372681-122372703 TCCAGGCACTCTTGGTATACAGG + Intronic
1060611046 9:124964809-124964831 TCCAGACCTTCTTGTTGTACTGG + Intronic
1060737199 9:126073613-126073635 TCTTGACCCTTTTGTTTCACTGG + Intergenic
1185741638 X:2538077-2538099 TTTAGGAACTTTTGTTTTACTGG + Intergenic
1189912756 X:45827721-45827743 AATAGGCCCGCTTGTTTTCCTGG + Intergenic
1194575712 X:95612082-95612104 TGTTGGCCCTCTTGTTTCATGGG - Intergenic
1195693403 X:107648250-107648272 TCCAGGACCTCTGGTTTTATAGG - Intronic
1195716636 X:107825258-107825280 TAACGACCCTCTTGTTTTACTGG + Intergenic
1195899660 X:109784031-109784053 TCCAGGCCTTCTTCTTTTATAGG + Intergenic
1197871784 X:131068476-131068498 CCTAGACCTTCTTGTTTTCCTGG - Intronic
1199205476 X:145144389-145144411 TCTAGGGCCTCTTTTTATAAGGG - Intergenic
1199660672 X:150047139-150047161 TCTTGGCCCTCTTCTTTTCTAGG + Intergenic