ID: 906628775

View in Genome Browser
Species Human (GRCh38)
Location 1:47347111-47347133
Sequence AAGGAGGAACAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7560
Summary {0: 1, 1: 2, 2: 98, 3: 951, 4: 6508}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906628775 Original CRISPR AAGGAGGAACAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr