ID: 906629034

View in Genome Browser
Species Human (GRCh38)
Location 1:47349634-47349656
Sequence GCACCTATAAAGTTGAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906629032_906629034 19 Left 906629032 1:47349592-47349614 CCTTTATTTCATGTTCATCTAGA 0: 1
1: 0
2: 2
3: 29
4: 282
Right 906629034 1:47349634-47349656 GCACCTATAAAGTTGAGAAAAGG 0: 1
1: 0
2: 1
3: 3
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906629034 Original CRISPR GCACCTATAAAGTTGAGAAA AGG Intronic
901485613 1:9558757-9558779 GCACCAATATAGGTGAGATACGG - Intronic
905518450 1:38579118-38579140 TCACCTACACAGTTGTGAAAGGG - Intergenic
906629034 1:47349634-47349656 GCACCTATAAAGTTGAGAAAAGG + Intronic
907322288 1:53612131-53612153 GCAGTTATGAAGTTGAGAAGTGG - Intronic
909210730 1:72819359-72819381 GAATCTATAAAATTTAGAAATGG + Intergenic
910343234 1:86211457-86211479 TCACCTATAAAGTTGTATAATGG - Intergenic
911138669 1:94472210-94472232 GCAGCTATAAATTTAAAAAATGG - Intronic
911795954 1:102076543-102076565 ACACATATACAGTTGGGAAACGG + Intergenic
912794022 1:112679639-112679661 GAACCTAGAAAATTGAGCAAGGG + Intronic
916864762 1:168844375-168844397 TGATCTATAAACTTGAGAAAAGG + Intergenic
917741963 1:177969592-177969614 GCACCTTTGCAGTTGGGAAAGGG - Intronic
920972671 1:210756092-210756114 GCACCTGTAGAGTTAGGAAATGG - Intronic
921009363 1:211125711-211125733 GCTTCTATAAAGAAGAGAAACGG - Intronic
921949762 1:220917316-220917338 TCACCTTTAAAGTCGTGAAAAGG + Intergenic
923965779 1:239137108-239137130 GCACATATATGGTTGACAAAGGG - Intergenic
924724647 1:246657872-246657894 GCATCTATAAATTCAAGAAACGG - Intronic
1065126518 10:22579427-22579449 GCACTGATAAAGCTGATAAATGG + Intronic
1065506216 10:26432614-26432636 TCACCTATAAAGAGGAGAAAGGG - Intergenic
1066056471 10:31685629-31685651 GGACAAATAAAGTAGAGAAAGGG - Intergenic
1067770052 10:49116184-49116206 GCACCTGTAAAATGGGGAAATGG + Intergenic
1072047082 10:91667588-91667610 GCACCATTAAAGCTGAGAATAGG - Intergenic
1073648197 10:105329028-105329050 GCACATTTAAATTTCAGAAATGG - Intergenic
1074218096 10:111407852-111407874 GCATCTTTAGAGTTAAGAAAAGG - Intergenic
1074779595 10:116791708-116791730 GCAACTAAATTGTTGAGAAAAGG + Intergenic
1075366341 10:121893498-121893520 TCTTTTATAAAGTTGAGAAAAGG - Intronic
1075949595 10:126465296-126465318 TCACCTATAAAATTGAGGTAAGG + Intronic
1077437178 11:2548493-2548515 ACACCTACAAGGCTGAGAAAGGG - Intronic
1079509837 11:21198061-21198083 GCACTTTTAAAGCTGGGAAATGG + Intronic
1079754260 11:24235463-24235485 GCACATATAAAATTTAGAATCGG - Intergenic
1081093303 11:38899940-38899962 GAATCTGTAAAGTGGAGAAAAGG + Intergenic
1081303174 11:41478343-41478365 GCACCTTAAAAGTTCACAAAGGG - Intergenic
1083559340 11:63659927-63659949 GCACCCATTAACTTGAGACAGGG - Intronic
1089029423 11:115309272-115309294 GCTCCAAAAAAGTTTAGAAAAGG + Intronic
1091910051 12:4223068-4223090 GCAACTTTATAGATGAGAAAAGG + Intergenic
1093789216 12:23228297-23228319 GCACACTTAAAGGTGAGAAAAGG - Intergenic
1094698714 12:32847388-32847410 TCATCTATAGAGTTGATAAATGG - Intronic
1095527448 12:43144321-43144343 ACACCAATGAAGTTGAGGAATGG - Intergenic
1096919074 12:55064848-55064870 ACATCTATAAGCTTGAGAAATGG + Intergenic
1097401815 12:59136964-59136986 GGAAGTAGAAAGTTGAGAAATGG + Intergenic
1098463482 12:70760181-70760203 GCACTTATAAACTTGAAATATGG - Intronic
1099234426 12:80066237-80066259 GTGACAATAAAGTTGAGAAAGGG + Intergenic
1100465642 12:94842422-94842444 TCATCTCTAGAGTTGAGAAAAGG - Intergenic
1102894409 12:116587251-116587273 GCACCTATAAAGGAGAAAAGAGG + Intergenic
1103054846 12:117810611-117810633 TCACCTTTAAAATTGAGACAGGG - Intronic
1104072580 12:125358746-125358768 GCAACTTTACAGTGGAGAAACGG - Intronic
1104315674 12:127698342-127698364 GCTTCTCTAAACTTGAGAAATGG - Intergenic
1106134683 13:26965243-26965265 GCACCTATCAAGTTGTGTCATGG + Intergenic
1107339207 13:39388026-39388048 GGAGGTATAAAGATGAGAAATGG + Intronic
1109341972 13:61074097-61074119 GAACCTATAATTTTGTGAAAAGG - Intergenic
1110792115 13:79598109-79598131 GTACCTATAAAGAACAGAAAGGG + Intergenic
1112699550 13:101990369-101990391 ACGCCTATATAGTTAAGAAAGGG + Intronic
1113367081 13:109686351-109686373 GCACATACAAGGTTGAGAAAAGG - Intergenic
1116225804 14:42150993-42151015 ACACATATAAACTTGAAAAATGG - Intergenic
1116424362 14:44771523-44771545 GCATCTATAACGATGAGCAATGG - Intergenic
1116674462 14:47887913-47887935 GAACCTGTTAAGTAGAGAAAAGG + Intergenic
1120865011 14:89288284-89288306 GCACCAATCAAGATAAGAAATGG + Intronic
1127478406 15:59356136-59356158 GCAGCTATAATGTTGAAAATGGG - Intronic
1129311669 15:74716842-74716864 GCACCTATAGTGTTGTCAAAGGG - Intergenic
1129502445 15:76052358-76052380 GGACTTAAAAAGTTGTGAAAGGG - Intronic
1130514743 15:84617626-84617648 TCACCTTTAAAGTTGAAAACAGG - Intronic
1131306154 15:91245152-91245174 GCATCTCTAAAGCTGAGAAGAGG + Intronic
1134428748 16:14180436-14180458 GTAACTATAAAGCTTAGAAATGG + Intronic
1138803223 16:60060543-60060565 GAAAACATAAAGTTGAGAAAGGG + Intergenic
1143209675 17:5175867-5175889 TCACCTATAAAGTTAAAATACGG + Intergenic
1143881563 17:10034049-10034071 GCACATATAAAGTAGGCAAATGG + Intronic
1152079743 17:78179411-78179433 GCACCTCTGAAGGTCAGAAACGG + Intronic
1153304014 18:3616119-3616141 GCACCTCTAAATCTGTGAAATGG - Intronic
1156535009 18:37853959-37853981 GTACGTATAAAGTAGAAAAATGG - Intergenic
1157626050 18:49052033-49052055 GCACCTAAAAGATTCAGAAAGGG + Intronic
1164778798 19:30875857-30875879 GGGCCTAGAAAGTTAAGAAATGG - Intergenic
925401990 2:3581228-3581250 GTATCTACAAAGTTGGGAAAGGG + Intergenic
925462611 2:4076418-4076440 TCACCTATAAAATTTTGAAATGG - Intergenic
925504963 2:4552237-4552259 TCAACTATAATGTTGAGACAAGG + Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
927457100 2:23262366-23262388 GCATCTATGAGTTTGAGAAAGGG + Intergenic
927618386 2:24623921-24623943 TCACATATAAACTTGAGAAGGGG + Intronic
927742493 2:25584281-25584303 ACAGCTATATAGTTGGGAAAGGG - Intronic
928224773 2:29439133-29439155 CCACCTATCAAGCTTAGAAAAGG + Intronic
929734674 2:44534954-44534976 TAACATATAAAGTTGATAAATGG + Intronic
931132101 2:59347997-59348019 GCAACTATAAATTTTAGCAAAGG - Intergenic
932295298 2:70619219-70619241 GCACTTTTAAAGTCGAAAAAGGG + Intronic
932736641 2:74259232-74259254 GCACCTTTAAAGATGGGATAGGG - Intronic
934865149 2:97802289-97802311 GGATCTATAAGGTTGAGAGAAGG - Intronic
936236144 2:110744327-110744349 GCAGTAATAAAGTTTAGAAAGGG + Intronic
937026901 2:118706338-118706360 ACACCTATAAAGGAGATAAATGG - Intergenic
940490747 2:154356615-154356637 GGACATATAAAATTGAGGAAAGG - Intronic
940591797 2:155738601-155738623 GTACCTCAAAAATTGAGAAAAGG - Intergenic
946923984 2:224607916-224607938 GAAGCTATAAAGTTAATAAATGG - Intergenic
1173530459 20:43765738-43765760 GCACCTAGAAATTCTAGAAAAGG - Intergenic
1178045635 21:28691015-28691037 ACACCTATAACCTTGACAAAGGG - Intergenic
1184716225 22:46283322-46283344 TCACATGTGAAGTTGAGAAAAGG - Intronic
953379735 3:42460048-42460070 GCTCCTAAAAAGCAGAGAAAAGG - Intergenic
963523445 3:146385595-146385617 GCAAATATAAAGTTTAAAAATGG - Intergenic
966462620 3:180194158-180194180 TCATCTATAAAGATGAGAAAGGG - Intergenic
967391975 3:188965244-188965266 GGATCTATGAAGTTGAGCAATGG - Intronic
971798902 4:31262828-31262850 GGGACTACAAAGTTGAGAAAGGG - Intergenic
972819378 4:42682409-42682431 GCAACTATGAAGTAGAAAAATGG - Intergenic
973724119 4:53755035-53755057 ACACCTATAAAAGTTAGAAAAGG + Intronic
979403361 4:120278898-120278920 GTATCTAAAAAGTTGAGATAAGG - Intergenic
986516278 5:8567103-8567125 GCACCTAAAAACTGAAGAAAAGG - Intergenic
988030382 5:25756304-25756326 GCAACTATACAGCTGACAAAGGG + Intergenic
992536313 5:77707530-77707552 GCACCTAAGAGGTTGAGACAGGG + Intronic
993293979 5:86110291-86110313 GCAGATATAAAGTTAAGATAAGG + Intergenic
995315768 5:110771240-110771262 ACACCAAAAAAGGTGAGAAAAGG - Intergenic
1004147829 6:13085488-13085510 GCAGCTATAAAGTTGATAAAAGG + Intronic
1005715383 6:28542613-28542635 GCTCCTCTAAATTTTAGAAAGGG + Intergenic
1007107721 6:39295174-39295196 GGGCCTATAAAGTTGTGGAAAGG + Intergenic
1007792485 6:44319312-44319334 GCAGCTGTGAAGATGAGAAATGG + Intronic
1008042781 6:46819510-46819532 GCACCTTTAAAGAGGAGAAGAGG - Exonic
1008795952 6:55303270-55303292 GCACCAAACAAGTGGAGAAAAGG + Intergenic
1009244562 6:61220267-61220289 GCTCCTAAAAACTTGAGAATTGG - Intergenic
1013648751 6:112172057-112172079 ACACCTACAAAGCTGAGAACTGG - Intronic
1014117298 6:117679846-117679868 GCATCAAGAAAGTGGAGAAATGG + Intronic
1015579204 6:134705125-134705147 GGACCTTGAAAGTTGGGAAAGGG - Intergenic
1016759284 6:147719358-147719380 GAGCCTAGAAAATTGAGAAAGGG + Intronic
1019825131 7:3278353-3278375 GCCACTATACAGTTGAGAATAGG + Intergenic
1020044354 7:5029732-5029754 GTTCCTATAAAGTTGTGAGATGG - Intronic
1022915644 7:34948410-34948432 ACACCTATACAGTGGAGAAGAGG - Intronic
1023504051 7:40881609-40881631 GCAACTATCATGTTAAGAAAGGG - Intergenic
1023638097 7:42233254-42233276 GCTCCTAAAAACTTAAGAAAAGG + Intronic
1027441733 7:78226423-78226445 TCAGCTATAAAGTTGAAATAAGG - Intronic
1028428349 7:90716872-90716894 GCACCTTGAAATTTGAGACATGG - Intronic
1036972769 8:13373486-13373508 ACACATATATAATTGAGAAAGGG - Intronic
1040054122 8:43042696-43042718 ACACATATAAAGTTCAAAAATGG + Intronic
1044822542 8:96164582-96164604 GCACTTTCAAAGTTGAGCAAGGG + Intergenic
1045429720 8:102102561-102102583 GCACCTAGCAAGTGGAAAAAGGG + Intronic
1047104109 8:121714245-121714267 GCACCTATACAAATGAGAAGAGG + Intergenic
1047164379 8:122420885-122420907 TCACCTATAAAGCTGGGCAAGGG + Intergenic
1047442398 8:124889563-124889585 GCACCTCTAGAGTTGAGATTTGG - Intergenic
1047909740 8:129515154-129515176 GCACCATTAAAGTTCTGAAAAGG + Intergenic
1049928780 9:435578-435600 GCCCCTATAAAGTTGAAGAGTGG - Intronic
1049954970 9:684368-684390 GCACCTATAAAGTTGGTACCAGG - Intronic
1050184158 9:2954547-2954569 TCACCTATAAAGATAATAAATGG + Intergenic
1052715369 9:32109835-32109857 GCACCTACAAAGCTGAGGACTGG + Intergenic
1052841683 9:33296764-33296786 CTATCTATAAAGGTGAGAAAAGG - Intronic
1054802098 9:69360176-69360198 GCACATATAACCTTGACAAATGG - Intronic
1058884116 9:109310302-109310324 GAACCTATAAAGAAAAGAAAGGG + Intronic
1185633651 X:1535874-1535896 TCCCCTAAAAAGCTGAGAAAAGG - Intronic
1189117088 X:38354063-38354085 TCACCTATAAAATGGAAAAAAGG + Intronic
1191970647 X:66811898-66811920 GCAACAATGAAGTTGGGAAAGGG - Intergenic
1195157543 X:102139499-102139521 GTAACTATAAAGTGGAGAGAGGG + Intergenic
1198769707 X:140116954-140116976 GCATATGTAAAGTGGAGAAAAGG - Intergenic
1199032073 X:143012646-143012668 ACGCCTAAAAAGATGAGAAAAGG + Intergenic