ID: 906630617

View in Genome Browser
Species Human (GRCh38)
Location 1:47364189-47364211
Sequence TCTAAGGTTTAGTAGTCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906630614_906630617 17 Left 906630614 1:47364149-47364171 CCTTTAGATATGGGTTCATGGCC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 906630617 1:47364189-47364211 TCTAAGGTTTAGTAGTCTTATGG 0: 1
1: 0
2: 0
3: 9
4: 109
906630615_906630617 -4 Left 906630615 1:47364170-47364192 CCAAAAGAAAAAAAAAGATTCTA 0: 1
1: 5
2: 67
3: 788
4: 4793
Right 906630617 1:47364189-47364211 TCTAAGGTTTAGTAGTCTTATGG 0: 1
1: 0
2: 0
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906630617 Original CRISPR TCTAAGGTTTAGTAGTCTTA TGG Intronic
902213881 1:14922992-14923014 TAAAAGGTTTTGTAGACTTAAGG + Intronic
906630617 1:47364189-47364211 TCTAAGGTTTAGTAGTCTTATGG + Intronic
906796054 1:48697166-48697188 TCTAAGCTTTACTATTCTGAAGG + Intronic
907108104 1:51902173-51902195 GCTGAGGTTGAGCAGTCTTATGG + Intergenic
907619312 1:55960120-55960142 TCTAATGTTTATTAGTCCTGTGG + Intergenic
910555313 1:88525330-88525352 TCTCAAGTCTAGTATTCTTAGGG - Intergenic
911529829 1:99031386-99031408 CCTAATGTATATTAGTCTTAAGG - Intergenic
917007947 1:170436413-170436435 CCTAACCTTTAGTAGGCTTATGG - Intergenic
918489032 1:185060632-185060654 TCTGAGGTTTAGTTGACTAATGG + Intronic
921548886 1:216508690-216508712 TCTAGGGGTTGGTAATCTTAGGG + Intronic
924354492 1:243156597-243156619 TCTAAGGAGTAGTAGACTTATGG - Intronic
1065487150 10:26246566-26246588 TCTAATTTTTAGTAGGCTTCAGG - Intronic
1068336570 10:55640568-55640590 TCTAAGGTTTAGCTTTCTTGTGG + Intergenic
1068870551 10:61939151-61939173 TCTAAGATTTTGTAATCTTAGGG + Intronic
1071022702 10:81077518-81077540 TCTAAGGTTTTATAGTTTTAGGG + Intergenic
1073909999 10:108330930-108330952 TCTAAGTTTTAGTTTTCTTTAGG + Intergenic
1074383612 10:113000008-113000030 TCTACGGTTAAGTAATTTTAGGG + Intronic
1074453806 10:113580445-113580467 TCTAAGGTTTTGTAACCTGATGG + Intronic
1075510432 10:123067823-123067845 TGTAAGGTTTTGTTTTCTTAAGG + Intergenic
1079806577 11:24938148-24938170 TCTAAGTTTTAGTATTTTTGTGG + Intronic
1080069512 11:28063570-28063592 GATAAGGTTTAGTAGGTTTAAGG - Intronic
1082887302 11:58100105-58100127 TCCAAGGGTTAGCATTCTTAAGG - Intronic
1090145211 11:124313986-124314008 TCTGAGGTTTAGTGAGCTTAGGG + Intergenic
1091170060 11:133512117-133512139 TCTGAAGTGGAGTAGTCTTATGG - Intronic
1092216342 12:6686171-6686193 TCTAAGGGTTGGTTGTGTTAAGG - Intronic
1097098740 12:56571150-56571172 TCAAAGGTTTAGGAGCCTTCAGG + Intronic
1098519085 12:71415341-71415363 TCTAAGGTTTATTCGTGTTGTGG - Intronic
1098972628 12:76872293-76872315 TCTAAGTCTGAGTCGTCTTATGG + Intronic
1101795231 12:107966922-107966944 TCTAAGTTTTAGTAGAAATAAGG + Intergenic
1102622122 12:114204330-114204352 TTTAAGGTTTAGGTATCTTAAGG + Intergenic
1102806844 12:115789128-115789150 TCTAAGGTCTAGTAATTCTAGGG + Intergenic
1106614313 13:31312728-31312750 ACTCAGTTTTATTAGTCTTATGG - Intronic
1107420624 13:40242895-40242917 TCAAAGGTTTTGTAGAGTTAGGG + Intergenic
1109430851 13:62232814-62232836 TCTAAGGTGGAATAATCTTAGGG - Intergenic
1109604516 13:64674980-64675002 TCTAAGGTTGAGTATTTTTTAGG + Intergenic
1111054473 13:82930841-82930863 TCAATAGTTTTGTAGTCTTAGGG + Intergenic
1111451791 13:88428622-88428644 TCTCAGGTTTGGGGGTCTTATGG - Intergenic
1111545863 13:89735120-89735142 TTTAAGGATTAGTACTTTTACGG + Intergenic
1114707369 14:24740996-24741018 TCTGAGGTGGAGCAGTCTTATGG - Intergenic
1116544401 14:46145473-46145495 TCTAAGGTTTTGTGGTGCTAGGG + Intergenic
1117002044 14:51380560-51380582 TCTCAGGTTTAGTGGGCTAATGG + Intergenic
1118265078 14:64287098-64287120 TATAAAGTTCAGTAGTGTTAAGG + Intronic
1118316073 14:64726864-64726886 CCTGAGGTTTTGCAGTCTTAGGG + Intronic
1126526184 15:49656982-49657004 CCTAATGTTTTGTAATCTTAGGG + Intergenic
1128122040 15:65157452-65157474 TCTAAGCATTAGAAGTCTTGAGG + Intronic
1138000352 16:53272158-53272180 TGTACGGTTTAGTAGTCGCATGG - Intronic
1140347131 16:74224556-74224578 TGTAAAGTTTAATAATCTTAGGG - Intergenic
1145192400 17:20855067-20855089 TCTAAGGTTTAGCTTTCTTGTGG + Intronic
1145402918 17:22558121-22558143 TCTAAGGTTTAGTTTTCTTGTGG + Intergenic
1149187035 17:54010484-54010506 TCTACTGTTCAGTAGTCCTATGG - Intergenic
1149276083 17:55039174-55039196 TCTAAGCTTTATTACTCTTATGG - Intronic
1156412401 18:36843768-36843790 TCTTTGGTTTAGTACTCTTTGGG + Intronic
1158353624 18:56591694-56591716 TTTAAGGTGTAGGAATCTTAAGG + Intergenic
1159370364 18:67520630-67520652 TCAAGGCTTTAGTAGACTTATGG - Intergenic
1159901496 18:74051656-74051678 TTTAAGGTTCAGAACTCTTATGG + Intergenic
1163147774 19:15392938-15392960 TCAAAGGTTTTGTAGTTTTCAGG - Intronic
1165528958 19:36380327-36380349 TCTAAAGTTTTATATTCTTAAGG - Intergenic
1165847162 19:38825657-38825679 ACTAAGGTTTGTTAGTCTGAGGG - Intronic
929423306 2:41817736-41817758 TATAAGGTTCAGTATACTTATGG - Intergenic
930442137 2:51422290-51422312 TCTGAGGTTTAGTAGAATTCTGG - Intergenic
938365803 2:130732774-130732796 TCTAAAGTCTAGCAGTCTTCAGG + Intergenic
940674191 2:156708810-156708832 TCAAAGGTTGAGTAGTCCCATGG - Intergenic
942998521 2:182295570-182295592 TCTACGGATTAATAGTCTTCAGG + Intronic
943792646 2:191951762-191951784 TAGAAGGTTTGGTGGTCTTAAGG + Intronic
1169945321 20:10982089-10982111 TCTTGGGTTTTGGAGTCTTAAGG - Intergenic
1174677107 20:52369125-52369147 TTTAACTTTTAGTAGTCTTCTGG - Intergenic
1174885733 20:54331677-54331699 TTTTATGTTTAGTAATCTTATGG + Intergenic
1177718058 21:24866233-24866255 TCTAAGTTTAAGTAGTCATGCGG + Intergenic
1179324648 21:40329691-40329713 CTTAAGGTTGAATAGTCTTAAGG - Intronic
949115629 3:318168-318190 TCACAGTTTTAGCAGTCTTAAGG - Intronic
955752866 3:62200196-62200218 TGTATGGTTCAGTAGTGTTAAGG - Intronic
965203090 3:165686055-165686077 TCTTAGGTTCTGTATTCTTAAGG + Intergenic
965203095 3:165686095-165686117 TCTCAGGTTTTGTATTCTTAGGG + Intergenic
966169024 3:177056676-177056698 TCTAAGGAAAAGTAGTTTTAGGG - Intronic
972971953 4:44587516-44587538 TATAAAGTTTAGGAGTCTTTTGG - Intergenic
975409307 4:74030705-74030727 TTTAAGGTTTGTTATTCTTATGG + Intergenic
975458357 4:74620144-74620166 CCTAACTTTCAGTAGTCTTAGGG + Intergenic
977854883 4:101877077-101877099 TCTAGGGGTTAGTGGCCTTAAGG + Intronic
978866471 4:113518648-113518670 TCTCAGGTTTCCTAGGCTTAAGG - Intronic
979247310 4:118523049-118523071 TCTAAAGAGTAGTAGACTTATGG + Intergenic
982457779 4:155630839-155630861 TCTAAGCTGTATTAGTCCTAAGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
985229657 4:187800750-187800772 TCTAAGGGTTATTGGCCTTAAGG + Intergenic
990857624 5:60287750-60287772 TCAAAGTTTTAGAAGTTTTAGGG - Intronic
991226594 5:64280422-64280444 TCTAGGGTTTTATAGTTTTATGG + Intronic
992518808 5:77525645-77525667 TCCAAATTTTAGTGGTCTTAAGG - Intronic
994136090 5:96288634-96288656 TCTAAGGTTTCCCAGTCTTTTGG - Intergenic
996456798 5:123693793-123693815 TCTAAGGTTTTGTGGGCTTAGGG - Intergenic
996686624 5:126288843-126288865 TGTTAGGTTTAGTTGTTTTATGG - Intergenic
996738866 5:126780652-126780674 TCTGAGGGTTAGTAGTGTTCTGG + Intronic
997850589 5:137329253-137329275 TCTAAGATTTGGTAGGCTCAAGG - Intronic
1000107751 5:158076451-158076473 TCTAAGTTTTAGTAGAGTGATGG - Intergenic
1000921447 5:167143007-167143029 TGTAAGCTTTAGTAGTCACATGG + Intergenic
1003014638 6:2458236-2458258 TCTAGGGTTAAGTCATCTTAGGG + Intergenic
1007932491 6:45705034-45705056 TTTAAGGTTCAGTAGTATTTTGG + Intergenic
1008064357 6:47031675-47031697 TCCAAGATTTAGTAGGTTTAGGG - Intronic
1012140052 6:95615559-95615581 TCTAAGTTTTGTTTGTCTTATGG + Intergenic
1012654751 6:101802689-101802711 TATAATGTTAATTAGTCTTAAGG + Intronic
1013607464 6:111763407-111763429 TTTAAGGTTTACTATTTTTAAGG + Intronic
1014024484 6:116629530-116629552 TGCAAGATTTAGTAGTCTAATGG - Intronic
1016231706 6:141813951-141813973 TCTACTGTTTATTAGTTTTATGG - Intergenic
1019093023 6:169555674-169555696 CCTAATGTTTGGTAATCTTACGG - Intronic
1027936937 7:84617860-84617882 TCTGAGGTTTAGAAATGTTAAGG + Intergenic
1036086090 8:5614727-5614749 TCTGAAGTTGTGTAGTCTTAAGG + Intergenic
1042414522 8:68503966-68503988 TATATGGTTTAGTAGTTTTTAGG + Intronic
1042700055 8:71602272-71602294 GCTTAGGTTTAGTAAACTTAGGG + Intergenic
1045132650 8:99173616-99173638 TTTAAGGCTTAGTAGTTTTAAGG - Intronic
1048524506 8:135189612-135189634 TCTAAGGTTTATTATTACTAGGG + Intergenic
1051066217 9:13106679-13106701 TCTAATGTTTTGTAGTCACATGG - Exonic
1051096108 9:13467055-13467077 CCTAAGGTTTATTAGTTTCATGG + Intergenic
1051777788 9:20655385-20655407 TTGAACGTTTAGAAGTCTTAGGG + Intergenic
1059878119 9:118658877-118658899 TCTAAGCTTTATTAGATTTAAGG - Intergenic
1186177616 X:6941641-6941663 TCTAAGGTTGAGTCATCTTGTGG + Intergenic
1189143370 X:38630007-38630029 TGGAAGGTTTAGGATTCTTATGG + Intronic
1193166242 X:78284258-78284280 TCTAAGTTTTTGTTGTCCTATGG + Intronic
1193626777 X:83831943-83831965 TCTAAGCTTTTCTAGTCTTTTGG - Intergenic
1194720086 X:97330040-97330062 TCTATGTTTGAGTAGTCATATGG - Intronic
1194862726 X:99023159-99023181 TGTAAGTTTAAGTAGTCTTAAGG - Intergenic
1197073592 X:122329118-122329140 TATCAGGTCTAGGAGTCTTATGG - Intergenic