ID: 906636206

View in Genome Browser
Species Human (GRCh38)
Location 1:47412343-47412365
Sequence GGAACATGGGGTAGGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906636206_906636220 22 Left 906636206 1:47412343-47412365 CCCTGGCCCCTACCCCATGTTCC No data
Right 906636220 1:47412388-47412410 TAGTGGTGCCTTTGCAGAGCTGG No data
906636206_906636224 29 Left 906636206 1:47412343-47412365 CCCTGGCCCCTACCCCATGTTCC No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636206_906636221 23 Left 906636206 1:47412343-47412365 CCCTGGCCCCTACCCCATGTTCC No data
Right 906636221 1:47412389-47412411 AGTGGTGCCTTTGCAGAGCTGGG No data
906636206_906636223 28 Left 906636206 1:47412343-47412365 CCCTGGCCCCTACCCCATGTTCC No data
Right 906636223 1:47412394-47412416 TGCCTTTGCAGAGCTGGGGCTGG No data
906636206_906636222 24 Left 906636206 1:47412343-47412365 CCCTGGCCCCTACCCCATGTTCC No data
Right 906636222 1:47412390-47412412 GTGGTGCCTTTGCAGAGCTGGGG No data
906636206_906636226 30 Left 906636206 1:47412343-47412365 CCCTGGCCCCTACCCCATGTTCC No data
Right 906636226 1:47412396-47412418 CCTTTGCAGAGCTGGGGCTGGGG No data
906636206_906636218 5 Left 906636206 1:47412343-47412365 CCCTGGCCCCTACCCCATGTTCC No data
Right 906636218 1:47412371-47412393 TCAAGGCCTGTCTTGGCTAGTGG No data
906636206_906636216 -2 Left 906636206 1:47412343-47412365 CCCTGGCCCCTACCCCATGTTCC No data
Right 906636216 1:47412364-47412386 CCTTGCCTCAAGGCCTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906636206 Original CRISPR GGAACATGGGGTAGGGGCCA GGG (reversed) Intergenic
No off target data available for this crispr