ID: 906636209

View in Genome Browser
Species Human (GRCh38)
Location 1:47412350-47412372
Sequence GAGGCAAGGAACATGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906636209_906636218 -2 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636218 1:47412371-47412393 TCAAGGCCTGTCTTGGCTAGTGG No data
906636209_906636222 17 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636222 1:47412390-47412412 GTGGTGCCTTTGCAGAGCTGGGG No data
906636209_906636227 24 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636227 1:47412397-47412419 CTTTGCAGAGCTGGGGCTGGGGG No data
906636209_906636220 15 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636220 1:47412388-47412410 TAGTGGTGCCTTTGCAGAGCTGG No data
906636209_906636226 23 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636226 1:47412396-47412418 CCTTTGCAGAGCTGGGGCTGGGG No data
906636209_906636228 28 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636228 1:47412401-47412423 GCAGAGCTGGGGCTGGGGGCAGG No data
906636209_906636224 22 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636209_906636221 16 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636221 1:47412389-47412411 AGTGGTGCCTTTGCAGAGCTGGG No data
906636209_906636229 29 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636229 1:47412402-47412424 CAGAGCTGGGGCTGGGGGCAGGG No data
906636209_906636223 21 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636223 1:47412394-47412416 TGCCTTTGCAGAGCTGGGGCTGG No data
906636209_906636216 -9 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636216 1:47412364-47412386 CCTTGCCTCAAGGCCTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906636209 Original CRISPR GAGGCAAGGAACATGGGGTA GGG (reversed) Intergenic
No off target data available for this crispr