ID: 906636212

View in Genome Browser
Species Human (GRCh38)
Location 1:47412355-47412377
Sequence GCCTTGAGGCAAGGAACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906636212_906636220 10 Left 906636212 1:47412355-47412377 CCCCATGTTCCTTGCCTCAAGGC No data
Right 906636220 1:47412388-47412410 TAGTGGTGCCTTTGCAGAGCTGG No data
906636212_906636218 -7 Left 906636212 1:47412355-47412377 CCCCATGTTCCTTGCCTCAAGGC No data
Right 906636218 1:47412371-47412393 TCAAGGCCTGTCTTGGCTAGTGG No data
906636212_906636221 11 Left 906636212 1:47412355-47412377 CCCCATGTTCCTTGCCTCAAGGC No data
Right 906636221 1:47412389-47412411 AGTGGTGCCTTTGCAGAGCTGGG No data
906636212_906636227 19 Left 906636212 1:47412355-47412377 CCCCATGTTCCTTGCCTCAAGGC No data
Right 906636227 1:47412397-47412419 CTTTGCAGAGCTGGGGCTGGGGG No data
906636212_906636226 18 Left 906636212 1:47412355-47412377 CCCCATGTTCCTTGCCTCAAGGC No data
Right 906636226 1:47412396-47412418 CCTTTGCAGAGCTGGGGCTGGGG No data
906636212_906636222 12 Left 906636212 1:47412355-47412377 CCCCATGTTCCTTGCCTCAAGGC No data
Right 906636222 1:47412390-47412412 GTGGTGCCTTTGCAGAGCTGGGG No data
906636212_906636223 16 Left 906636212 1:47412355-47412377 CCCCATGTTCCTTGCCTCAAGGC No data
Right 906636223 1:47412394-47412416 TGCCTTTGCAGAGCTGGGGCTGG No data
906636212_906636224 17 Left 906636212 1:47412355-47412377 CCCCATGTTCCTTGCCTCAAGGC No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636212_906636229 24 Left 906636212 1:47412355-47412377 CCCCATGTTCCTTGCCTCAAGGC No data
Right 906636229 1:47412402-47412424 CAGAGCTGGGGCTGGGGGCAGGG No data
906636212_906636228 23 Left 906636212 1:47412355-47412377 CCCCATGTTCCTTGCCTCAAGGC No data
Right 906636228 1:47412401-47412423 GCAGAGCTGGGGCTGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906636212 Original CRISPR GCCTTGAGGCAAGGAACATG GGG (reversed) Intergenic
No off target data available for this crispr