ID: 906636219

View in Genome Browser
Species Human (GRCh38)
Location 1:47412377-47412399
Sequence AAGGCACCACTAGCCAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906636219_906636224 -5 Left 906636219 1:47412377-47412399 CCTGTCTTGGCTAGTGGTGCCTT No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636219_906636223 -6 Left 906636219 1:47412377-47412399 CCTGTCTTGGCTAGTGGTGCCTT No data
Right 906636223 1:47412394-47412416 TGCCTTTGCAGAGCTGGGGCTGG No data
906636219_906636230 12 Left 906636219 1:47412377-47412399 CCTGTCTTGGCTAGTGGTGCCTT No data
Right 906636230 1:47412412-47412434 GCTGGGGGCAGGGAGTCTTGCGG No data
906636219_906636227 -3 Left 906636219 1:47412377-47412399 CCTGTCTTGGCTAGTGGTGCCTT No data
Right 906636227 1:47412397-47412419 CTTTGCAGAGCTGGGGCTGGGGG No data
906636219_906636222 -10 Left 906636219 1:47412377-47412399 CCTGTCTTGGCTAGTGGTGCCTT No data
Right 906636222 1:47412390-47412412 GTGGTGCCTTTGCAGAGCTGGGG No data
906636219_906636229 2 Left 906636219 1:47412377-47412399 CCTGTCTTGGCTAGTGGTGCCTT No data
Right 906636229 1:47412402-47412424 CAGAGCTGGGGCTGGGGGCAGGG No data
906636219_906636228 1 Left 906636219 1:47412377-47412399 CCTGTCTTGGCTAGTGGTGCCTT No data
Right 906636228 1:47412401-47412423 GCAGAGCTGGGGCTGGGGGCAGG No data
906636219_906636231 13 Left 906636219 1:47412377-47412399 CCTGTCTTGGCTAGTGGTGCCTT No data
Right 906636231 1:47412413-47412435 CTGGGGGCAGGGAGTCTTGCGGG No data
906636219_906636226 -4 Left 906636219 1:47412377-47412399 CCTGTCTTGGCTAGTGGTGCCTT No data
Right 906636226 1:47412396-47412418 CCTTTGCAGAGCTGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906636219 Original CRISPR AAGGCACCACTAGCCAAGAC AGG (reversed) Intergenic
No off target data available for this crispr