ID: 906636224

View in Genome Browser
Species Human (GRCh38)
Location 1:47412395-47412417
Sequence GCCTTTGCAGAGCTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906636207_906636224 28 Left 906636207 1:47412344-47412366 CCTGGCCCCTACCCCATGTTCCT No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636215_906636224 8 Left 906636215 1:47412364-47412386 CCTTGCCTCAAGGCCTGTCTTGG No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636210_906636224 21 Left 906636210 1:47412351-47412373 CCTACCCCATGTTCCTTGCCTCA No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636212_906636224 17 Left 906636212 1:47412355-47412377 CCCCATGTTCCTTGCCTCAAGGC No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636209_906636224 22 Left 906636209 1:47412350-47412372 CCCTACCCCATGTTCCTTGCCTC No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636208_906636224 23 Left 906636208 1:47412349-47412371 CCCCTACCCCATGTTCCTTGCCT No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636219_906636224 -5 Left 906636219 1:47412377-47412399 CCTGTCTTGGCTAGTGGTGCCTT No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636206_906636224 29 Left 906636206 1:47412343-47412365 CCCTGGCCCCTACCCCATGTTCC No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636217_906636224 3 Left 906636217 1:47412369-47412391 CCTCAAGGCCTGTCTTGGCTAGT No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636214_906636224 15 Left 906636214 1:47412357-47412379 CCATGTTCCTTGCCTCAAGGCCT No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data
906636213_906636224 16 Left 906636213 1:47412356-47412378 CCCATGTTCCTTGCCTCAAGGCC No data
Right 906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906636224 Original CRISPR GCCTTTGCAGAGCTGGGGCT GGG Intergenic
No off target data available for this crispr