ID: 906636975

View in Genome Browser
Species Human (GRCh38)
Location 1:47416385-47416407
Sequence GGCGACGGCGGCGGCCCCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1811
Summary {0: 1, 1: 0, 2: 11, 3: 121, 4: 1678}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906636975_906636982 -1 Left 906636975 1:47416385-47416407 CCGTCGGGGCCGCCGCCGTCGCC 0: 1
1: 0
2: 11
3: 121
4: 1678
Right 906636982 1:47416407-47416429 CGCTCGCAGGAGCCGAGCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 78
906636975_906636987 15 Left 906636975 1:47416385-47416407 CCGTCGGGGCCGCCGCCGTCGCC 0: 1
1: 0
2: 11
3: 121
4: 1678
Right 906636987 1:47416423-47416445 GCCAGGGCGGGAGCCAGAGGAGG 0: 1
1: 0
2: 12
3: 61
4: 672
906636975_906636991 25 Left 906636975 1:47416385-47416407 CCGTCGGGGCCGCCGCCGTCGCC 0: 1
1: 0
2: 11
3: 121
4: 1678
Right 906636991 1:47416433-47416455 GAGCCAGAGGAGGCGGCGGCTGG 0: 1
1: 0
2: 6
3: 79
4: 700
906636975_906636983 2 Left 906636975 1:47416385-47416407 CCGTCGGGGCCGCCGCCGTCGCC 0: 1
1: 0
2: 11
3: 121
4: 1678
Right 906636983 1:47416410-47416432 TCGCAGGAGCCGAGCCAGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 161
906636975_906636989 18 Left 906636975 1:47416385-47416407 CCGTCGGGGCCGCCGCCGTCGCC 0: 1
1: 0
2: 11
3: 121
4: 1678
Right 906636989 1:47416426-47416448 AGGGCGGGAGCCAGAGGAGGCGG 0: 1
1: 2
2: 8
3: 121
4: 1256
906636975_906636990 21 Left 906636975 1:47416385-47416407 CCGTCGGGGCCGCCGCCGTCGCC 0: 1
1: 0
2: 11
3: 121
4: 1678
Right 906636990 1:47416429-47416451 GCGGGAGCCAGAGGAGGCGGCGG 0: 1
1: 0
2: 6
3: 108
4: 1056
906636975_906636981 -2 Left 906636975 1:47416385-47416407 CCGTCGGGGCCGCCGCCGTCGCC 0: 1
1: 0
2: 11
3: 121
4: 1678
Right 906636981 1:47416406-47416428 CCGCTCGCAGGAGCCGAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 154
906636975_906636984 3 Left 906636975 1:47416385-47416407 CCGTCGGGGCCGCCGCCGTCGCC 0: 1
1: 0
2: 11
3: 121
4: 1678
Right 906636984 1:47416411-47416433 CGCAGGAGCCGAGCCAGGGCGGG 0: 1
1: 0
2: 2
3: 46
4: 426
906636975_906636986 12 Left 906636975 1:47416385-47416407 CCGTCGGGGCCGCCGCCGTCGCC 0: 1
1: 0
2: 11
3: 121
4: 1678
Right 906636986 1:47416420-47416442 CGAGCCAGGGCGGGAGCCAGAGG 0: 1
1: 0
2: 4
3: 36
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906636975 Original CRISPR GGCGACGGCGGCGGCCCCGA CGG (reversed) Exonic