ID: 906637078

View in Genome Browser
Species Human (GRCh38)
Location 1:47416845-47416867
Sequence GAGCGGCGGCCCTGGCGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906637078_906637093 26 Left 906637078 1:47416845-47416867 CCGCGGCGCCAGGGCCGCCGCTC 0: 1
1: 0
2: 1
3: 26
4: 272
Right 906637093 1:47416894-47416916 CGCGCCCGGCCCCGCGCTGCTGG 0: 1
1: 0
2: 8
3: 47
4: 382
906637078_906637088 12 Left 906637078 1:47416845-47416867 CCGCGGCGCCAGGGCCGCCGCTC 0: 1
1: 0
2: 1
3: 26
4: 272
Right 906637088 1:47416880-47416902 GCGCCCTACGCGCCCGCGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906637078 Original CRISPR GAGCGGCGGCCCTGGCGCCG CGG (reversed) Exonic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900410867 1:2512067-2512089 GAGAGGCTTCCCTGGCCCCGTGG - Intronic
901405015 1:9039707-9039729 GGGCGTGGGTCCTGGCGCCGAGG - Intronic
901630322 1:10644839-10644861 GAGAGGCGGCCCAGGCCACGGGG + Intronic
902600973 1:17539963-17539985 GCGCGGGGGCCCTGCCTCCGCGG + Intronic
903573415 1:24322583-24322605 CGGCGGCGGCCCGGGCGGCGCGG + Intronic
903666723 1:25012451-25012473 GAGCGCCAGCCCTGGAGCCCAGG - Intergenic
903950600 1:26993991-26994013 GAGCTGCAGCGCTGGCGCCAGGG + Exonic
904782917 1:32964340-32964362 GGGCGGTGGCCCGGGCGCGGAGG - Exonic
905409981 1:37761897-37761919 CAGCAGCATCCCTGGCGCCGCGG - Exonic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
906720001 1:47997446-47997468 GAGGGGAGGACCTGGCGCGGGGG + Intergenic
907213557 1:52843154-52843176 GGGAGGCGGCCTGGGCGCCGCGG + Intronic
907278101 1:53327991-53328013 CAGCGGCAACCCCGGCGCCGCGG - Exonic
908501219 1:64745225-64745247 GCGCGGCGGGGCTGGGGCCGGGG + Exonic
911696427 1:100895184-100895206 GAGCGGCGGCCGTTGCCCCGGGG + Exonic
912619519 1:111140564-111140586 GAGCGCCGGCGCGGGAGCCGGGG + Intronic
912659531 1:111515664-111515686 CTGAGGGGGCCCTGGCGCCGGGG + Intronic
912818140 1:112846330-112846352 GAGCGCCGGGCCGGGCGCGGTGG - Intergenic
914455351 1:147831652-147831674 GAGCAGCTGCCCGGGCGCGGTGG - Intergenic
914803024 1:150974367-150974389 GGCCGGCGGGCCTGGCGCCGCGG - Intronic
915326789 1:155084921-155084943 GAGCGGCGGCACTAGGGCCCCGG + Intronic
916773634 1:167937011-167937033 GAGCGGGGGCCCCGGGGCGGAGG + Intronic
918043378 1:180926709-180926731 GAGAGGCGCCCCTGCAGCCGTGG - Intronic
919929939 1:202214495-202214517 AAGCGGCGGCCCCGGGGGCGGGG - Intronic
920511787 1:206557240-206557262 GAGGGAGGGCGCTGGCGCCGGGG + Intronic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
923775981 1:236978811-236978833 GATCGCGGGCCCTGACGCCGTGG - Intergenic
1063429641 10:5977481-5977503 GAGCTGCCGCCATGGCCCCGCGG - Exonic
1064202900 10:13299744-13299766 GCGCGGCCGCCCTGGGGTCGGGG - Intronic
1064208918 10:13347627-13347649 GAGCGGCCGGCCTGGGGTCGCGG - Intronic
1064209034 10:13347975-13347997 AAGCGGCGGGCCCGGCGCGGGGG - Intronic
1065020457 10:21497475-21497497 CAGAGGCGTCCCTGGCGCCTTGG - Intergenic
1065188870 10:23192958-23192980 GAGCGGCGGCTGCGGCGGCGCGG + Exonic
1066220672 10:33334804-33334826 GAGCCGCGGAGCTGGCGCCCAGG + Exonic
1066221240 10:33336935-33336957 GAGCGGCGGCCGGGGCGGCCTGG + Intergenic
1068690161 10:59906310-59906332 GGGCGGCGGCGGTGGCGGCGGGG - Exonic
1069438554 10:68407344-68407366 GAGCGGCGCCCCGGGCGGGGCGG + Intergenic
1072710557 10:97713518-97713540 GAGCTGGGGGCCTGGCGCAGAGG + Intronic
1073268304 10:102241438-102241460 GAGAGGCGGCCCGGGAGCAGGGG - Exonic
1074866127 10:117545339-117545361 CCGCAGCCGCCCTGGCGCCGCGG - Intronic
1075031830 10:119029401-119029423 GAGCGGCGCCCGAGGCGCCGGGG + Intergenic
1075401298 10:122163379-122163401 GAGCCGCGGCCCGGGAGCTGGGG - Intronic
1078246098 11:9574144-9574166 GAGCGGCGGCGCTCGGGCCCGGG - Exonic
1080388680 11:31825296-31825318 GAGCGGCTTCTCTGGCGCTGCGG - Intronic
1082814584 11:57499671-57499693 GAGCAGCGGCCCAGGGGGCGGGG + Intronic
1083598363 11:63931097-63931119 GAGCAGCGGCCCTGGCCAAGCGG + Intergenic
1083658484 11:64241503-64241525 GAGCGGAGGCGCTGGGGGCGGGG + Intronic
1084171274 11:67401970-67401992 GCGCGGCGGCCCGGGGGGCGGGG + Intronic
1084195830 11:67523292-67523314 GCCAAGCGGCCCTGGCGCCGGGG - Exonic
1084420092 11:69056178-69056200 GAGCGGCAGGGCTGGCGCTGAGG - Intronic
1084700715 11:70784819-70784841 GAGCGTGGGCCCTGGCCCCGGGG - Intronic
1087175195 11:95089763-95089785 GCGGGGCGGCCCGGGCGGCGGGG - Intergenic
1090636652 11:128694150-128694172 GCGCGGCCTCCCTGGCGCCCTGG - Exonic
1091124498 11:133082780-133082802 GCGAGGAGGCCCAGGCGCCGGGG - Intronic
1091689026 12:2583263-2583285 GGCCGGCTGCCCTGGGGCCGCGG + Intronic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1093958617 12:25250351-25250373 GAGGGGAGGCCGGGGCGCCGCGG + Intronic
1094202067 12:27804693-27804715 GAGTGGGGGCCCTGGCGCAGTGG - Intergenic
1097676068 12:62603467-62603489 GAGAGGCGGCGCCGGCGCCCGGG - Exonic
1103271940 12:119680590-119680612 GATCTGCAGCCCTGGCCCCGCGG + Exonic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104049488 12:125186268-125186290 GAGGGGCCGCCCGGGAGCCGGGG - Intergenic
1104841681 12:131828760-131828782 GCGCGGGAGCCCTGGCGCCCTGG + Intronic
1104866808 12:131960850-131960872 GAGCGTGGGCCCTGTCGTCGGGG + Exonic
1104929286 12:132329616-132329638 GCGGGGCGGTCCTGGGGCCGCGG - Intergenic
1105745621 13:23375126-23375148 GAGCAGCGGCTGTGGCGCGGCGG - Exonic
1105855273 13:24366300-24366322 GAGCGCCGGCCCTGCTGCCCTGG + Intergenic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1112652559 13:101415848-101415870 AGGCAGCGGCCCTGGTGCCGAGG + Intronic
1113493996 13:110713864-110713886 AGGCGGCGGGGCTGGCGCCGGGG - Intronic
1113542016 13:111115910-111115932 GAGGGGCGGCGCGGGCGGCGGGG + Intronic
1115473639 14:33793694-33793716 GAGCGGCAGCTCTGGAGCCAGGG - Intronic
1117899120 14:60515085-60515107 GCGCGCTGGCCCGGGCGCCGAGG + Intronic
1119539259 14:75428096-75428118 CGGCGGCGGGGCTGGCGCCGCGG + Intronic
1119620919 14:76131332-76131354 GAGCGCTGACCCTGGCGCCTCGG + Intergenic
1121685443 14:95832035-95832057 GAGAGGCTGCCCTGGCCCCTGGG + Intergenic
1122978660 14:105181427-105181449 GCGCGGCTTCCCTGGCACCGCGG - Intergenic
1122993298 14:105248980-105249002 CGGCGGCGGCGCTGGCGCGGGGG - Exonic
1123004532 14:105314900-105314922 GAGCGGCGGGGCCGGCGCCATGG + Exonic
1202899776 14_GL000194v1_random:28356-28378 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1123411945 15:20067877-20067899 GAGGGGCTGCCCAGGCCCCGGGG + Intergenic
1123521289 15:21074996-21075018 GAGGGGCTGCCCAGGCCCCGGGG + Intergenic
1126035004 15:44537367-44537389 GGGCGGCGGCACTGCCGGCGGGG + Exonic
1126134556 15:45378082-45378104 GGGCGGCGCCCCCTGCGCCGTGG + Intronic
1126592556 15:50354777-50354799 CAGCGGCGGCGCGGGCGCCCAGG + Intronic
1130152783 15:81324142-81324164 GAGCGGCGGCGCTGGATCCCGGG + Intronic
1131692788 15:94845023-94845045 GACTGGCGGCCCTGGGCCCGCGG - Intergenic
1132560203 16:590069-590091 GCGCGGCGGCCCTGGTGGTGCGG + Intronic
1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG + Intronic
1132828941 16:1918293-1918315 TAGCGGCGGCCTGGGCGGCGGGG - Exonic
1132841156 16:1979095-1979117 CGAGGGCGGCCCTGGCGCCGTGG + Exonic
1132841158 16:1979104-1979126 GAGCGGCGCCCACGGCGCCAGGG - Exonic
1132887819 16:2190194-2190216 GAGCAGAGGCCCTGGCGCCCCGG + Intronic
1132934513 16:2473946-2473968 GGGGGGCGGGCCTGGAGCCGCGG + Exonic
1132939387 16:2499423-2499445 GAGCAGGGGCCCTGGAGCCAGGG + Intronic
1135400331 16:22162493-22162515 GCCCGGTGGCCCTGGCGGCGCGG + Intergenic
1135822009 16:25692804-25692826 GAGCGGCGGCGGAGGCGCCCAGG + Exonic
1136129643 16:28211735-28211757 TGGCGGCGGCCCCGGCCCCGAGG + Exonic
1136362679 16:29790926-29790948 GAGAGGCGGCCATGGCGCAGGGG + Intronic
1136462163 16:30418310-30418332 CAGTGGCGGCCGTGGCGCCAGGG - Exonic
1136574765 16:31116975-31116997 GAGCGGCCGCCCTGGTGGCCTGG - Intronic
1136620987 16:31428172-31428194 GCGCGGCGGTCCTGGGGCGGCGG + Intronic
1142379022 16:89721429-89721451 GAGCGGGGGCGCTGGCACCGCGG + Intronic
1142762795 17:2051420-2051442 GAACCGCGGGCCTGGGGCCGGGG + Intergenic
1142764406 17:2057388-2057410 CAGCGGCCGCTCTGGCGCCGCGG - Exonic
1142988990 17:3716577-3716599 GAGCAGCTGCCCTGGCCTCGTGG - Intronic
1143057503 17:4173305-4173327 GAGCAGCAGGCCAGGCGCCGCGG + Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143375418 17:6464203-6464225 GTGCCGCGGCCCCGGCGCCTGGG - Exonic
1143519162 17:7435918-7435940 GAGCGGCCGAGCTGGGGCCGGGG - Exonic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144339746 17:14301685-14301707 GAGCAGCAGCCCCGGCGCGGCGG - Exonic
1145110355 17:20156452-20156474 GCCCGGCGGCCCCGGCGCCCAGG - Intronic
1146142350 17:30378999-30379021 GAGCGGCCGCCTTGGCGGCTAGG + Exonic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1146763486 17:35498065-35498087 GAGCGGCGGCGAGGGCGGCGGGG + Intronic
1147134758 17:38428456-38428478 CAGCGGCGGCTCTGCGGCCGGGG - Exonic
1147402804 17:40191276-40191298 GAGGGGCGGCCAGGGCGCCAGGG - Intronic
1147833636 17:43314721-43314743 GAGCCTCGGCCCTGGCACTGTGG - Intergenic
1148698695 17:49575886-49575908 GAGCGGCGCCGCTGGAGCCGAGG + Exonic
1151224867 17:72640576-72640598 GGGCGCCGGGCGTGGCGCCGGGG - Intergenic
1151370811 17:73645123-73645145 CAGCGGCGGCCGAGGCGCTGGGG - Intergenic
1151555213 17:74843173-74843195 CAGGGGCGGCCCCGGCGTCGGGG + Exonic
1151696676 17:75721523-75721545 TAGCGGCAGCCCAGGCGCGGAGG + Exonic
1151780184 17:76240364-76240386 GCGCTGCGGCTCTGGCGGCGGGG + Exonic
1152362436 17:79838973-79838995 GGGCGGGGGCCCGGGGGCCGAGG - Intronic
1152657505 17:81526918-81526940 GAGAGCAGGCCCTGGCGTCGTGG + Intergenic
1153892968 18:9535107-9535129 TAGCAGCGGCCCTGCTGCCGTGG - Intronic
1156495853 18:37524805-37524827 GAGCCGCGGCCGGGGCGCGGAGG - Intronic
1157588345 18:48819506-48819528 GAGCGCCGGCCCTGGCTGCTGGG + Intronic
1158601981 18:58863694-58863716 GAGCTGCGGCCCAGACGCCCGGG + Intronic
1158884759 18:61816297-61816319 GTGCGGTGCCCCTGGTGCCGCGG - Exonic
1160099250 18:75904918-75904940 GCGCCGTGGCCCTGGTGCCGGGG - Intergenic
1160100686 18:75916855-75916877 GCGCGGAGGCCCAGGCGCAGCGG + Intergenic
1160256237 18:77250607-77250629 GAACAGCGGCCCGGGCTCCGGGG - Exonic
1160454848 18:78992962-78992984 GCTCTGCGGCGCTGGCGCCGGGG - Exonic
1160509826 18:79447186-79447208 AAGAGGCGGCCCTTGCTCCGTGG - Intronic
1160719161 19:589995-590017 CGGCGGCGGCCCCGGCGCGGGGG - Exonic
1160723679 19:608375-608397 GAGGGGCGGGCCCGGCCCCGGGG + Intronic
1160875802 19:1295754-1295776 GAGCGGCCCCCCGGGCGCCGCGG - Exonic
1161006768 19:1941112-1941134 CAGCCGCGGCCACGGCGCCGGGG - Intergenic
1161057930 19:2199990-2200012 GGGCGGTGGCCATGGCACCGGGG + Intronic
1161060174 19:2210864-2210886 GAGCGGGGGCCGTGGCGTGGGGG - Intronic
1161154760 19:2726881-2726903 GAGCTGCAGCCCTGGCTCTGGGG - Intronic
1161720010 19:5897421-5897443 GAGCTGGGGCCCTGGTGCCAGGG - Intronic
1161845008 19:6707360-6707382 GAGGGGAGGCCCTGGCGGCGGGG - Intronic
1162024996 19:7888701-7888723 GTGCGCCGGCCCTGTGGCCGGGG + Intronic
1162027709 19:7903919-7903941 GCGCGGCGGCGGTGGCGGCGGGG + Exonic
1162128237 19:8510867-8510889 GCGCGGCGGCCCGGCCGCGGGGG + Exonic
1162374461 19:10296502-10296524 GGGCGGCGGCGCTGGCGGGGCGG + Exonic
1162929879 19:13952554-13952576 GAGCGGCGGCGGCGGCCCCGGGG + Exonic
1163313047 19:16525460-16525482 GAGCAGCCGCCCTGGGGCGGGGG - Exonic
1163729192 19:18940064-18940086 GAGGGGAGGCCCTGGCCCAGCGG + Intronic
1164713196 19:30373916-30373938 GGGCTGCGGCCCTGGGGCTGGGG - Intronic
1165097093 19:33415382-33415404 GAGCGGCAGGCCGGGCGCAGTGG + Intronic
1165243013 19:34482139-34482161 CAGCGGCGGCCCCGAGGCCGGGG + Exonic
1166751207 19:45164761-45164783 CAGCCGCTGCTCTGGCGCCGGGG + Intronic
1167466268 19:49652374-49652396 GGGCGGCGGGGCGGGCGCCGGGG - Exonic
1167613450 19:50518192-50518214 GAGAGGAGGCCCTGCAGCCGCGG - Exonic
925928181 2:8685383-8685405 GGGCGGGGGCCGTGGAGCCGCGG + Intergenic
926101696 2:10122401-10122423 GGGCTGCGGCCCTGGTCCCGCGG + Exonic
928143541 2:28751685-28751707 GCGCGGCGGCCCAGGCGTCGAGG + Intronic
929188678 2:39120678-39120700 GGGCGGGGGGCCTGGCCCCGGGG - Intronic
929604177 2:43224534-43224556 GTGCGGCGGCCCCGGCGGGGAGG + Exonic
932496553 2:72148527-72148549 GAGCGGCGGGCGAGGCGGCGAGG + Intergenic
936072881 2:109383082-109383104 GAGGGCGGGCCCTGGCTCCGAGG + Intronic
937045146 2:118847177-118847199 GCGCGGCGGCCGGGGCGGCGGGG - Exonic
937931084 2:127205658-127205680 GAGGGGCGACGCTGGCTCCGTGG - Exonic
937993068 2:127674907-127674929 GAGCGGGGATCGTGGCGCCGCGG + Intronic
938831259 2:135052279-135052301 GAGCGCCGGGCCTGGCGCTAAGG - Exonic
942565830 2:177264374-177264396 GAGCCGCCGCGCTTGCGCCGGGG - Intronic
943692459 2:190881751-190881773 GAGCGGCCTCTCTGGCGCTGGGG - Intronic
944811135 2:203328449-203328471 GAGCGGCGGCCGCAGCGCCAAGG - Exonic
945948081 2:216013432-216013454 CAGCGGCAGCCCGGGCGTCGCGG + Exonic
947840502 2:233204557-233204579 CAGCGGCGGCCGCGGCGTCGGGG - Exonic
948449635 2:238061056-238061078 TGGAGGCGGCCGTGGCGCCGGGG + Exonic
1168801395 20:645638-645660 GAGGGACGGCCCTGCCGCGGGGG + Intergenic
1169213039 20:3778191-3778213 GAGCGGCGGCCCGGGCCGCGCGG - Exonic
1170026144 20:11891212-11891234 GCGCGGAGGTCCTGGTGCCGGGG + Intronic
1170570529 20:17629796-17629818 GGGCGGCGGCAGTGGGGCCGGGG - Intronic
1170617790 20:17968413-17968435 GAACCGCGGCCATGGCGACGCGG + Exonic
1170629643 20:18056485-18056507 GGGCGGCGGCCAGGGCGCCTCGG - Intronic
1171459371 20:25290311-25290333 GAGCTGGGGCCTTGGGGCCGGGG + Intronic
1172359609 20:34303003-34303025 GCGCGGCGGCCCCGGCGTCGCGG + Intronic
1172482245 20:35277893-35277915 AAGCGGCGGCCGCGGCGCCCCGG - Intergenic
1173734274 20:45348372-45348394 GGGCGGGGGCCATGGCACCGCGG + Exonic
1174054023 20:47785738-47785760 GAGCGTCGGGCCGGGAGCCGCGG + Intronic
1174607014 20:51768405-51768427 GGGCGGCGGCCCAGGCGGCGCGG - Exonic
1175847279 20:62065485-62065507 GAGGGGGGGCCCGGGCGCTGCGG + Exonic
1176619151 21:9043130-9043152 CAGCGCCGGCGCAGGCGCCGGGG - Intergenic
1176767973 21:13038549-13038571 GGGCGGCCGTCCTGGCCCCGAGG + Intergenic
1178707802 21:34889395-34889417 GAGCCGCGGCCCGGGCGCAGCGG - Intronic
1179024444 21:37668105-37668127 GAGCTGAGGCCCTGGGGCTGTGG - Intronic
1180908376 22:19431595-19431617 GCGCGGCGGCCCTGAGGGCGCGG - Exonic
1181695992 22:24593028-24593050 GCGCGGCGGCCATGGGGGCGCGG - Exonic
1182199402 22:28553664-28553686 GGGCGGCTGGCCTGGCGCGGGGG - Intronic
1183868647 22:40723879-40723901 GAGCGGGGGCCCTGGCGTGCAGG + Intergenic
1184712737 22:46262804-46262826 GGGCCGCGGGCCTGGCGCGGCGG + Exonic
1184720311 22:46308780-46308802 GTGCGGAGGCCCCGGCGCCCGGG - Exonic
1185278573 22:49960446-49960468 GGGTGGCGGCCGTGGCGCCTCGG - Intergenic
950024298 3:9810046-9810068 GAGCTGGGGCCCGGGCGCCGGGG + Exonic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950316347 3:12004745-12004767 GGGCTGCGGCGCGGGCGCCGAGG - Exonic
954735796 3:52705790-52705812 GCGGGGCAGCCCTGCCGCCGGGG + Exonic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
955298661 3:57756766-57756788 GAGCGGCGGCCCAGAAGCCTAGG + Exonic
956675018 3:71725272-71725294 GAGCGGCGGCTCGGGGGCGGCGG + Exonic
961013406 3:123449815-123449837 GAGCCGAGGCCCGGGCGGCGCGG - Intergenic
961377308 3:126475598-126475620 GCACGGCGGCGCTGCCGCCGAGG - Exonic
962804191 3:138915541-138915563 GTGGGGCGGGCCTGCCGCCGGGG - Intergenic
963253316 3:143120916-143120938 CAGCGGCGTCCTGGGCGCCGGGG - Exonic
964358387 3:155870676-155870698 GAGCGCGGGCCCCAGCGCCGCGG - Exonic
966201081 3:177359913-177359935 GAGCTCCGGCTCTGCCGCCGCGG - Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966874610 3:184314995-184315017 GGGCGGCGGGCCGGGAGCCGTGG - Intronic
967024740 3:185554878-185554900 AAGCGGCGGGCCGGGCGCGGTGG - Intergenic
968230780 3:197003426-197003448 CAGGGGCGCCCCGGGCGCCGGGG + Exonic
968512273 4:1000996-1001018 GAGCGCAGGCCCTGGGGCCCTGG + Intronic
969285575 4:6200162-6200184 GAGGGGCGGACCTGGCGGCAAGG - Intronic
969715743 4:8867406-8867428 GGGGGGTGGCCGTGGCGCCGGGG + Exonic
972739049 4:41873693-41873715 AGGCGGAGGCCCCGGCGCCGAGG + Intergenic
974385736 4:61200917-61200939 GAGCGGGCGCCCGGCCGCCGAGG - Intergenic
977810033 4:101347386-101347408 GAGCGCCGCCGCTGGTGCCGCGG + Exonic
980075152 4:128287237-128287259 GTGCGGCGGCCGAGGCGCGGGGG + Intronic
980827379 4:138089048-138089070 GAGCGGCGGCAACGGCGCGGCGG - Intergenic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
984707444 4:182857943-182857965 GAGTGCCGGCCCGGGCGCGGTGG + Intergenic
985471705 5:50825-50847 CAGAGGCGGTCCTGGCGCCAGGG - Intergenic
985762950 5:1761015-1761037 GAGCGCCGGGCCAGGCCCCGGGG + Intergenic
986758625 5:10859914-10859936 TAGAGCCGGCCCTGGGGCCGTGG - Intergenic
987379932 5:17275609-17275631 GAGCGCGGCCCCTGCCGCCGGGG + Exonic
991474372 5:67004155-67004177 GAGCGGCGGCCCAGGCTGCGGGG + Intronic
992111547 5:73498724-73498746 GGGCGGCTGCCCTGGGGGCGAGG + Exonic
992249939 5:74866474-74866496 GGGCGGCGTCCCAGGCTCCGAGG - Intronic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
994411405 5:99410770-99410792 GAGCGGAGGCCCAGGAGGCGCGG + Intergenic
994482422 5:100354477-100354499 GAGCGGAGGCCCAGGAGGCGCGG - Intergenic
1001529867 5:172454341-172454363 GAGGAGCGGCCATGCCGCCGCGG - Exonic
1006374020 6:33662144-33662166 GAGGGGCAGCCATGGCCCCGGGG + Intronic
1013009575 6:106107137-106107159 GCGCTGCGGCCCCGGCGCCTGGG + Exonic
1013472411 6:110476829-110476851 GAGCGGCGGCGCTGGGGGCGAGG - Intergenic
1018062423 6:160101515-160101537 GAGCGGCAGCCCTTGCGGCTGGG + Intronic
1018442726 6:163828134-163828156 GAGCAGAGGTCCTGCCGCCGTGG + Intergenic
1019166900 6:170103099-170103121 GAGATGTGGCCCTGGCCCCGGGG - Intergenic
1019192658 6:170262210-170262232 CAGTGGCGGCCCTGGCGCTCTGG - Intergenic
1019733172 7:2638457-2638479 GAGAGGCAGCCCTGGGGCTGAGG - Intronic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1021827987 7:24573550-24573572 GAGCGGCGGCAGCGGCGGCGCGG + Exonic
1022105220 7:27192212-27192234 TAGAGGCGGCCGTGGCGCGGAGG + Intergenic
1022697936 7:32728433-32728455 GAGCGGCGGCCCTGGACGTGCGG + Intergenic
1023703055 7:42911767-42911789 GAGCCGCGGCGCTGGCGGTGGGG - Intronic
1027248004 7:76380138-76380160 GAGCCGCGCCCCTGGCCCCACGG - Intergenic
1028899139 7:96076200-96076222 GAGCGGCGGCTCAGGCGCCCGGG + Intronic
1029361026 7:100088882-100088904 GTGCGGCGGGCCTGGCGTCCGGG - Intergenic
1029640763 7:101817446-101817468 GCGCGGAGTCCCCGGCGCCGCGG + Intronic
1029709727 7:102293049-102293071 GGGCGGTGGCCCTGGGGGCGGGG - Intronic
1030176517 7:106660473-106660495 CAGCGGCCGCCCGGGCTCCGCGG + Exonic
1032195175 7:129784584-129784606 GAGCGGAGGCACTGGGGCGGCGG + Intergenic
1033033168 7:137846610-137846632 GAGCTGCTGCCTGGGCGCCGAGG - Exonic
1035404204 7:158587655-158587677 GAGCGGCGGCCCCATCCCCGCGG + Exonic
1036454056 8:8892917-8892939 GCGCGTCGGCCCCGGCCCCGGGG + Exonic
1036723649 8:11200751-11200773 GGGCGGCGGGCTGGGCGCCGTGG - Exonic
1038789813 8:30658248-30658270 GCTTGGCTGCCCTGGCGCCGCGG - Exonic
1038883612 8:31640103-31640125 GGACCGCGGCCCTGGCGCCGGGG + Intronic
1039554866 8:38468315-38468337 CTGCGGAGGCCCCGGCGCCGCGG + Intronic
1040471255 8:47737626-47737648 GCGCGGCGGCTCCGGCGACGTGG + Exonic
1041839166 8:62248948-62248970 GAGCGGCGGCCGCGGGGCCGAGG + Exonic
1043563477 8:81522256-81522278 CAGCGGCGGCGCTGGAGCGGCGG + Intergenic
1045583223 8:103500814-103500836 CAGCGGCGGCACCGGCGCGGCGG - Intronic
1049346913 8:142144059-142144081 GAGGGGCAGCCCTGGTGCCCAGG - Intergenic
1049406254 8:142452965-142452987 GAGCCGCGGGCCAGGCGCGGAGG - Intronic
1049620940 8:143598013-143598035 GGGCCGCGGCCCGGGCGCGGGGG - Exonic
1049694535 8:143976907-143976929 GAGCGGCGGGGCTGGGGCCCGGG + Intergenic
1050721810 9:8599903-8599925 GAGGGGCCGGCCAGGCGCCGTGG - Intronic
1054333334 9:63781656-63781678 GAGCGCCGGCGCAGGCGCGGAGG + Intergenic
1057490476 9:95516313-95516335 GAGGGGCGGGCCGCGCGCCGGGG - Intronic
1057786002 9:98087739-98087761 GGGCGGCGGCCGAGGCCCCGCGG + Exonic
1058508841 9:105694518-105694540 GCGCGTGCGCCCTGGCGCCGAGG - Intergenic
1061038668 9:128127517-128127539 GAGCTGCGGCGCTGGCCCTGGGG - Exonic
1061293663 9:129666041-129666063 GCGCCTCGGCCCTGGCCCCGGGG - Exonic
1061317342 9:129804570-129804592 GAGCCAAGGGCCTGGCGCCGTGG + Intronic
1061490189 9:130940049-130940071 GCGCGGCGGCCAAGGCGCCCCGG - Intergenic
1061559588 9:131394079-131394101 GAGCGGCGAGACAGGCGCCGAGG + Intronic
1061765386 9:132878287-132878309 GCGCGGCGGCCCTAGCGACGCGG - Exonic
1061961673 9:133991971-133991993 CGGCGGCGGCCCAGGCGCCCTGG - Intronic
1062228133 9:135465445-135465467 GAGAGTCGGCCGTGGCGCCAAGG + Intergenic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062325006 9:136008696-136008718 GGGCGGCGGCCCGGGCTCAGAGG - Exonic
1203782390 EBV:107926-107948 GAGCGGCGGCGGTTGCGCCCGGG - Intergenic
1187154697 X:16712275-16712297 GAGGGATGGCCCGGGCGCCGAGG + Intronic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1192447946 X:71224496-71224518 GCGCCGCAGCCCTGGCACCGGGG + Exonic
1192705550 X:73526116-73526138 GAGCGGCGGCTGCGGCTCCGGGG - Intergenic
1198205375 X:134460317-134460339 GACCCGCAGCCCTGGCGTCGTGG + Exonic
1199772832 X:150984709-150984731 CAGCGGCGGCCCGGGCGGGGCGG - Intronic
1200051475 X:153434070-153434092 GAGCGGAGGCCATGGATCCGGGG + Intergenic