ID: 906638359

View in Genome Browser
Species Human (GRCh38)
Location 1:47425496-47425518
Sequence CTGTCTCCCTTGAGTTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906638358_906638359 -10 Left 906638358 1:47425483-47425505 CCTGGGCATCAGTCTGTCTCCCT No data
Right 906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG No data
906638351_906638359 18 Left 906638351 1:47425455-47425477 CCCTGCTTGAGGGAGACACAGGT No data
Right 906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG No data
906638356_906638359 -6 Left 906638356 1:47425479-47425501 CCACCCTGGGCATCAGTCTGTCT No data
Right 906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG No data
906638357_906638359 -9 Left 906638357 1:47425482-47425504 CCCTGGGCATCAGTCTGTCTCCC No data
Right 906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG No data
906638352_906638359 17 Left 906638352 1:47425456-47425478 CCTGCTTGAGGGAGACACAGGTC No data
Right 906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG No data
906638349_906638359 24 Left 906638349 1:47425449-47425471 CCTGGACCCTGCTTGAGGGAGAC No data
Right 906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG No data
906638355_906638359 -5 Left 906638355 1:47425478-47425500 CCCACCCTGGGCATCAGTCTGTC No data
Right 906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906638359 Original CRISPR CTGTCTCCCTTGAGTTATGA AGG Intergenic
No off target data available for this crispr