ID: 906639424

View in Genome Browser
Species Human (GRCh38)
Location 1:47432839-47432861
Sequence CGCCCTTCCGGGCCCTGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906639424_906639427 -9 Left 906639424 1:47432839-47432861 CCAATTCAGGGCCCGGAAGGGCG No data
Right 906639427 1:47432853-47432875 GGAAGGGCGTCCTGTTCCCGAGG No data
906639424_906639437 30 Left 906639424 1:47432839-47432861 CCAATTCAGGGCCCGGAAGGGCG No data
Right 906639437 1:47432892-47432914 GGCGGCGTGTAATTGGTAGGAGG No data
906639424_906639434 23 Left 906639424 1:47432839-47432861 CCAATTCAGGGCCCGGAAGGGCG No data
Right 906639434 1:47432885-47432907 GCCAGCAGGCGGCGTGTAATTGG No data
906639424_906639431 9 Left 906639424 1:47432839-47432861 CCAATTCAGGGCCCGGAAGGGCG No data
Right 906639431 1:47432871-47432893 CGAGGTGCCACTGTGCCAGCAGG No data
906639424_906639432 12 Left 906639424 1:47432839-47432861 CCAATTCAGGGCCCGGAAGGGCG No data
Right 906639432 1:47432874-47432896 GGTGCCACTGTGCCAGCAGGCGG No data
906639424_906639436 27 Left 906639424 1:47432839-47432861 CCAATTCAGGGCCCGGAAGGGCG No data
Right 906639436 1:47432889-47432911 GCAGGCGGCGTGTAATTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906639424 Original CRISPR CGCCCTTCCGGGCCCTGAAT TGG (reversed) Intergenic