ID: 906639427

View in Genome Browser
Species Human (GRCh38)
Location 1:47432853-47432875
Sequence GGAAGGGCGTCCTGTTCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906639414_906639427 6 Left 906639414 1:47432824-47432846 CCCTCCTGCGCTGCCCCAATTCA No data
Right 906639427 1:47432853-47432875 GGAAGGGCGTCCTGTTCCCGAGG No data
906639421_906639427 -7 Left 906639421 1:47432837-47432859 CCCCAATTCAGGGCCCGGAAGGG No data
Right 906639427 1:47432853-47432875 GGAAGGGCGTCCTGTTCCCGAGG No data
906639413_906639427 9 Left 906639413 1:47432821-47432843 CCTCCCTCCTGCGCTGCCCCAAT No data
Right 906639427 1:47432853-47432875 GGAAGGGCGTCCTGTTCCCGAGG No data
906639424_906639427 -9 Left 906639424 1:47432839-47432861 CCAATTCAGGGCCCGGAAGGGCG No data
Right 906639427 1:47432853-47432875 GGAAGGGCGTCCTGTTCCCGAGG No data
906639418_906639427 2 Left 906639418 1:47432828-47432850 CCTGCGCTGCCCCAATTCAGGGC No data
Right 906639427 1:47432853-47432875 GGAAGGGCGTCCTGTTCCCGAGG No data
906639423_906639427 -8 Left 906639423 1:47432838-47432860 CCCAATTCAGGGCCCGGAAGGGC No data
Right 906639427 1:47432853-47432875 GGAAGGGCGTCCTGTTCCCGAGG No data
906639412_906639427 10 Left 906639412 1:47432820-47432842 CCCTCCCTCCTGCGCTGCCCCAA No data
Right 906639427 1:47432853-47432875 GGAAGGGCGTCCTGTTCCCGAGG No data
906639415_906639427 5 Left 906639415 1:47432825-47432847 CCTCCTGCGCTGCCCCAATTCAG No data
Right 906639427 1:47432853-47432875 GGAAGGGCGTCCTGTTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906639427 Original CRISPR GGAAGGGCGTCCTGTTCCCG AGG Intergenic