ID: 906639432

View in Genome Browser
Species Human (GRCh38)
Location 1:47432874-47432896
Sequence GGTGCCACTGTGCCAGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906639418_906639432 23 Left 906639418 1:47432828-47432850 CCTGCGCTGCCCCAATTCAGGGC No data
Right 906639432 1:47432874-47432896 GGTGCCACTGTGCCAGCAGGCGG No data
906639413_906639432 30 Left 906639413 1:47432821-47432843 CCTCCCTCCTGCGCTGCCCCAAT No data
Right 906639432 1:47432874-47432896 GGTGCCACTGTGCCAGCAGGCGG No data
906639425_906639432 1 Left 906639425 1:47432850-47432872 CCCGGAAGGGCGTCCTGTTCCCG No data
Right 906639432 1:47432874-47432896 GGTGCCACTGTGCCAGCAGGCGG No data
906639423_906639432 13 Left 906639423 1:47432838-47432860 CCCAATTCAGGGCCCGGAAGGGC No data
Right 906639432 1:47432874-47432896 GGTGCCACTGTGCCAGCAGGCGG No data
906639415_906639432 26 Left 906639415 1:47432825-47432847 CCTCCTGCGCTGCCCCAATTCAG No data
Right 906639432 1:47432874-47432896 GGTGCCACTGTGCCAGCAGGCGG No data
906639424_906639432 12 Left 906639424 1:47432839-47432861 CCAATTCAGGGCCCGGAAGGGCG No data
Right 906639432 1:47432874-47432896 GGTGCCACTGTGCCAGCAGGCGG No data
906639421_906639432 14 Left 906639421 1:47432837-47432859 CCCCAATTCAGGGCCCGGAAGGG No data
Right 906639432 1:47432874-47432896 GGTGCCACTGTGCCAGCAGGCGG No data
906639426_906639432 0 Left 906639426 1:47432851-47432873 CCGGAAGGGCGTCCTGTTCCCGA No data
Right 906639432 1:47432874-47432896 GGTGCCACTGTGCCAGCAGGCGG No data
906639414_906639432 27 Left 906639414 1:47432824-47432846 CCCTCCTGCGCTGCCCCAATTCA No data
Right 906639432 1:47432874-47432896 GGTGCCACTGTGCCAGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906639432 Original CRISPR GGTGCCACTGTGCCAGCAGG CGG Intergenic