ID: 906639436

View in Genome Browser
Species Human (GRCh38)
Location 1:47432889-47432911
Sequence GCAGGCGGCGTGTAATTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906639425_906639436 16 Left 906639425 1:47432850-47432872 CCCGGAAGGGCGTCCTGTTCCCG No data
Right 906639436 1:47432889-47432911 GCAGGCGGCGTGTAATTGGTAGG No data
906639428_906639436 3 Left 906639428 1:47432863-47432885 CCTGTTCCCGAGGTGCCACTGTG No data
Right 906639436 1:47432889-47432911 GCAGGCGGCGTGTAATTGGTAGG No data
906639429_906639436 -3 Left 906639429 1:47432869-47432891 CCCGAGGTGCCACTGTGCCAGCA No data
Right 906639436 1:47432889-47432911 GCAGGCGGCGTGTAATTGGTAGG No data
906639423_906639436 28 Left 906639423 1:47432838-47432860 CCCAATTCAGGGCCCGGAAGGGC No data
Right 906639436 1:47432889-47432911 GCAGGCGGCGTGTAATTGGTAGG No data
906639424_906639436 27 Left 906639424 1:47432839-47432861 CCAATTCAGGGCCCGGAAGGGCG No data
Right 906639436 1:47432889-47432911 GCAGGCGGCGTGTAATTGGTAGG No data
906639421_906639436 29 Left 906639421 1:47432837-47432859 CCCCAATTCAGGGCCCGGAAGGG No data
Right 906639436 1:47432889-47432911 GCAGGCGGCGTGTAATTGGTAGG No data
906639426_906639436 15 Left 906639426 1:47432851-47432873 CCGGAAGGGCGTCCTGTTCCCGA No data
Right 906639436 1:47432889-47432911 GCAGGCGGCGTGTAATTGGTAGG No data
906639430_906639436 -4 Left 906639430 1:47432870-47432892 CCGAGGTGCCACTGTGCCAGCAG No data
Right 906639436 1:47432889-47432911 GCAGGCGGCGTGTAATTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906639436 Original CRISPR GCAGGCGGCGTGTAATTGGT AGG Intergenic