ID: 906639437

View in Genome Browser
Species Human (GRCh38)
Location 1:47432892-47432914
Sequence GGCGGCGTGTAATTGGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906639433_906639437 -9 Left 906639433 1:47432878-47432900 CCACTGTGCCAGCAGGCGGCGTG No data
Right 906639437 1:47432892-47432914 GGCGGCGTGTAATTGGTAGGAGG No data
906639424_906639437 30 Left 906639424 1:47432839-47432861 CCAATTCAGGGCCCGGAAGGGCG No data
Right 906639437 1:47432892-47432914 GGCGGCGTGTAATTGGTAGGAGG No data
906639429_906639437 0 Left 906639429 1:47432869-47432891 CCCGAGGTGCCACTGTGCCAGCA No data
Right 906639437 1:47432892-47432914 GGCGGCGTGTAATTGGTAGGAGG No data
906639428_906639437 6 Left 906639428 1:47432863-47432885 CCTGTTCCCGAGGTGCCACTGTG No data
Right 906639437 1:47432892-47432914 GGCGGCGTGTAATTGGTAGGAGG No data
906639425_906639437 19 Left 906639425 1:47432850-47432872 CCCGGAAGGGCGTCCTGTTCCCG No data
Right 906639437 1:47432892-47432914 GGCGGCGTGTAATTGGTAGGAGG No data
906639430_906639437 -1 Left 906639430 1:47432870-47432892 CCGAGGTGCCACTGTGCCAGCAG No data
Right 906639437 1:47432892-47432914 GGCGGCGTGTAATTGGTAGGAGG No data
906639426_906639437 18 Left 906639426 1:47432851-47432873 CCGGAAGGGCGTCCTGTTCCCGA No data
Right 906639437 1:47432892-47432914 GGCGGCGTGTAATTGGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906639437 Original CRISPR GGCGGCGTGTAATTGGTAGG AGG Intergenic