ID: 906640691

View in Genome Browser
Species Human (GRCh38)
Location 1:47438929-47438951
Sequence CAGCCCGTAGCCGTAGCCGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 19}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906640691_906640698 9 Left 906640691 1:47438929-47438951 CCTACGGCTACGGCTACGGGCTG 0: 1
1: 0
2: 1
3: 1
4: 19
Right 906640698 1:47438961-47438983 GCCTACGGCGCACCCCCGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 73
906640691_906640697 8 Left 906640691 1:47438929-47438951 CCTACGGCTACGGCTACGGGCTG 0: 1
1: 0
2: 1
3: 1
4: 19
Right 906640697 1:47438960-47438982 GGCCTACGGCGCACCCCCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 25
906640691_906640701 14 Left 906640691 1:47438929-47438951 CCTACGGCTACGGCTACGGGCTG 0: 1
1: 0
2: 1
3: 1
4: 19
Right 906640701 1:47438966-47438988 CGGCGCACCCCCGCCGGGGCCGG 0: 1
1: 0
2: 0
3: 22
4: 215
906640691_906640694 -6 Left 906640691 1:47438929-47438951 CCTACGGCTACGGCTACGGGCTG 0: 1
1: 0
2: 1
3: 1
4: 19
Right 906640694 1:47438946-47438968 GGGCTGGCTCTCCCGGCCTACGG 0: 1
1: 0
2: 1
3: 14
4: 165
906640691_906640700 10 Left 906640691 1:47438929-47438951 CCTACGGCTACGGCTACGGGCTG 0: 1
1: 0
2: 1
3: 1
4: 19
Right 906640700 1:47438962-47438984 CCTACGGCGCACCCCCGCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906640691 Original CRISPR CAGCCCGTAGCCGTAGCCGT AGG (reversed) Exonic
900512798 1:3068457-3068479 AAGCCCGAAGCAGCAGCCGTTGG + Intergenic
903907308 1:26696217-26696239 CAGCCCGGAGCCTGAGCCGGCGG + Exonic
906640691 1:47438929-47438951 CAGCCCGTAGCCGTAGCCGTAGG - Exonic
919823886 1:201490232-201490254 CTGCCCGTAGCCATAGCCTTTGG + Exonic
1084087347 11:66860629-66860651 CAGCCCTTGGCCGCAGCCCTGGG - Intronic
1141523157 16:84594791-84594813 CAGCCCGAAGCCTTGGCCATGGG - Intronic
1146737299 17:35249625-35249647 CAGCCCTTAACTGTAGCCCTTGG + Intronic
1147769335 17:42856801-42856823 CAGCCTGGAGCCGTGGCCGAGGG + Exonic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1166733117 19:45069681-45069703 CACCCAGTAGACGTAGCCATTGG + Intronic
944414901 2:199470973-199470995 CAGCCCCTGGCTGTAGCCTTTGG - Intronic
946999660 2:225439489-225439511 CAGCCTGTAGCCATAGAGGTGGG + Intronic
1171724430 20:28603038-28603060 CAGCCCGCAGCTCTAGCGGTAGG - Intergenic
1174386590 20:50191258-50191280 CAGCCCGTACCTGGAGCCGCTGG + Exonic
954289139 3:49639991-49640013 CAACCTGTAGCAGTAGCCCTGGG + Intronic
962808994 3:138946153-138946175 CGCCAGGTAGCCGTAGCCGTCGG + Exonic
966860963 3:184230642-184230664 CAACCCGCAGCCGCAGCCGGTGG + Exonic
992105612 5:73447523-73447545 CAGGCCGTAGCCGCAGCCGTAGG + Exonic
999150453 5:149422959-149422981 CAGCCCGCAGCAGTGGCCATGGG - Intergenic
1016330275 6:142946572-142946594 CCGCCCGCAGCGGCAGCCGTGGG - Intergenic
1032552989 7:132803142-132803164 CAGCCCATAGAAGTAGCCCTTGG + Intronic
1049844586 8:144793628-144793650 CAGCCCCTGGCCCTAGCTGTGGG - Intergenic