ID: 906642231

View in Genome Browser
Species Human (GRCh38)
Location 1:47448388-47448410
Sequence CGAAAACTAGAGACATTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906642231_906642239 30 Left 906642231 1:47448388-47448410 CCAGTGAATGTCTCTAGTTTTCG No data
Right 906642239 1:47448441-47448463 TTTTGCTTTCGTGAGTCTGTTGG No data
906642231_906642233 -8 Left 906642231 1:47448388-47448410 CCAGTGAATGTCTCTAGTTTTCG No data
Right 906642233 1:47448403-47448425 AGTTTTCGGATCTTCCAGTGTGG No data
906642231_906642234 -5 Left 906642231 1:47448388-47448410 CCAGTGAATGTCTCTAGTTTTCG No data
Right 906642234 1:47448406-47448428 TTTCGGATCTTCCAGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906642231 Original CRISPR CGAAAACTAGAGACATTCAC TGG (reversed) Intergenic
No off target data available for this crispr