ID: 906644750

View in Genome Browser
Species Human (GRCh38)
Location 1:47466315-47466337
Sequence CCTGAAGAACCTGGGAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906644750_906644756 30 Left 906644750 1:47466315-47466337 CCACAGCTCCCAGGTTCTTCAGG No data
Right 906644756 1:47466368-47466390 TGTCACTCTATTCCCCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906644750 Original CRISPR CCTGAAGAACCTGGGAGCTG TGG (reversed) Intergenic