ID: 906644753 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:47466324-47466346 |
Sequence | AGGTATTGTCCTGAAGAACC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
906644753_906644756 | 21 | Left | 906644753 | 1:47466324-47466346 | CCAGGTTCTTCAGGACAATACCT | No data | ||
Right | 906644756 | 1:47466368-47466390 | TGTCACTCTATTCCCCAGAGCGG | No data | ||||
906644753_906644757 | 22 | Left | 906644753 | 1:47466324-47466346 | CCAGGTTCTTCAGGACAATACCT | No data | ||
Right | 906644757 | 1:47466369-47466391 | GTCACTCTATTCCCCAGAGCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
906644753 | Original CRISPR | AGGTATTGTCCTGAAGAACC TGG (reversed) | Intergenic | ||