ID: 906644753

View in Genome Browser
Species Human (GRCh38)
Location 1:47466324-47466346
Sequence AGGTATTGTCCTGAAGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906644753_906644757 22 Left 906644753 1:47466324-47466346 CCAGGTTCTTCAGGACAATACCT No data
Right 906644757 1:47466369-47466391 GTCACTCTATTCCCCAGAGCGGG No data
906644753_906644756 21 Left 906644753 1:47466324-47466346 CCAGGTTCTTCAGGACAATACCT No data
Right 906644756 1:47466368-47466390 TGTCACTCTATTCCCCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906644753 Original CRISPR AGGTATTGTCCTGAAGAACC TGG (reversed) Intergenic
No off target data available for this crispr