ID: 906644754

View in Genome Browser
Species Human (GRCh38)
Location 1:47466344-47466366
Sequence CAGAGTGGAGCATATGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906644754_906644762 28 Left 906644754 1:47466344-47466366 CCTCTGTCATATGCTCCACTCTG No data
Right 906644762 1:47466395-47466417 TAGCAGGTGTGCTGAATGTCAGG No data
906644754_906644757 2 Left 906644754 1:47466344-47466366 CCTCTGTCATATGCTCCACTCTG No data
Right 906644757 1:47466369-47466391 GTCACTCTATTCCCCAGAGCGGG No data
906644754_906644758 12 Left 906644754 1:47466344-47466366 CCTCTGTCATATGCTCCACTCTG No data
Right 906644758 1:47466379-47466401 TCCCCAGAGCGGGAGTTAGCAGG No data
906644754_906644756 1 Left 906644754 1:47466344-47466366 CCTCTGTCATATGCTCCACTCTG No data
Right 906644756 1:47466368-47466390 TGTCACTCTATTCCCCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906644754 Original CRISPR CAGAGTGGAGCATATGACAG AGG (reversed) Intergenic