ID: 906644756

View in Genome Browser
Species Human (GRCh38)
Location 1:47466368-47466390
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906644754_906644756 1 Left 906644754 1:47466344-47466366 CCTCTGTCATATGCTCCACTCTG No data
Right 906644756 1:47466368-47466390 TGTCACTCTATTCCCCAGAGCGG No data
906644753_906644756 21 Left 906644753 1:47466324-47466346 CCAGGTTCTTCAGGACAATACCT No data
Right 906644756 1:47466368-47466390 TGTCACTCTATTCCCCAGAGCGG No data
906644752_906644756 22 Left 906644752 1:47466323-47466345 CCCAGGTTCTTCAGGACAATACC No data
Right 906644756 1:47466368-47466390 TGTCACTCTATTCCCCAGAGCGG No data
906644750_906644756 30 Left 906644750 1:47466315-47466337 CCACAGCTCCCAGGTTCTTCAGG No data
Right 906644756 1:47466368-47466390 TGTCACTCTATTCCCCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type