ID: 906644757

View in Genome Browser
Species Human (GRCh38)
Location 1:47466369-47466391
Sequence GTCACTCTATTCCCCAGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906644752_906644757 23 Left 906644752 1:47466323-47466345 CCCAGGTTCTTCAGGACAATACC No data
Right 906644757 1:47466369-47466391 GTCACTCTATTCCCCAGAGCGGG No data
906644754_906644757 2 Left 906644754 1:47466344-47466366 CCTCTGTCATATGCTCCACTCTG No data
Right 906644757 1:47466369-47466391 GTCACTCTATTCCCCAGAGCGGG No data
906644753_906644757 22 Left 906644753 1:47466324-47466346 CCAGGTTCTTCAGGACAATACCT No data
Right 906644757 1:47466369-47466391 GTCACTCTATTCCCCAGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906644757 Original CRISPR GTCACTCTATTCCCCAGAGC GGG Intergenic
No off target data available for this crispr