ID: 906644757 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:47466369-47466391 |
Sequence | GTCACTCTATTCCCCAGAGC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
906644753_906644757 | 22 | Left | 906644753 | 1:47466324-47466346 | CCAGGTTCTTCAGGACAATACCT | No data | ||
Right | 906644757 | 1:47466369-47466391 | GTCACTCTATTCCCCAGAGCGGG | No data | ||||
906644754_906644757 | 2 | Left | 906644754 | 1:47466344-47466366 | CCTCTGTCATATGCTCCACTCTG | No data | ||
Right | 906644757 | 1:47466369-47466391 | GTCACTCTATTCCCCAGAGCGGG | No data | ||||
906644752_906644757 | 23 | Left | 906644752 | 1:47466323-47466345 | CCCAGGTTCTTCAGGACAATACC | No data | ||
Right | 906644757 | 1:47466369-47466391 | GTCACTCTATTCCCCAGAGCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
906644757 | Original CRISPR | GTCACTCTATTCCCCAGAGC GGG | Intergenic | ||