ID: 906648503

View in Genome Browser
Species Human (GRCh38)
Location 1:47493267-47493289
Sequence CCTGCATGGAGCTTAGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906648503_906648512 17 Left 906648503 1:47493267-47493289 CCTTGACCTAAGCTCCATGCAGG No data
Right 906648512 1:47493307-47493329 TTTCAGTGCCCTCCCCAAAAGGG No data
906648503_906648513 18 Left 906648503 1:47493267-47493289 CCTTGACCTAAGCTCCATGCAGG No data
Right 906648513 1:47493308-47493330 TTCAGTGCCCTCCCCAAAAGGGG No data
906648503_906648511 16 Left 906648503 1:47493267-47493289 CCTTGACCTAAGCTCCATGCAGG No data
Right 906648511 1:47493306-47493328 TTTTCAGTGCCCTCCCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906648503 Original CRISPR CCTGCATGGAGCTTAGGTCA AGG (reversed) Intergenic