ID: 906648511

View in Genome Browser
Species Human (GRCh38)
Location 1:47493306-47493328
Sequence TTTTCAGTGCCCTCCCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906648508_906648511 2 Left 906648508 1:47493281-47493303 CCATGCAGGCAGGGACCAAGCCT No data
Right 906648511 1:47493306-47493328 TTTTCAGTGCCCTCCCCAAAAGG No data
906648501_906648511 28 Left 906648501 1:47493255-47493277 CCCTGCAAGAATCCTTGACCTAA No data
Right 906648511 1:47493306-47493328 TTTTCAGTGCCCTCCCCAAAAGG No data
906648503_906648511 16 Left 906648503 1:47493267-47493289 CCTTGACCTAAGCTCCATGCAGG No data
Right 906648511 1:47493306-47493328 TTTTCAGTGCCCTCCCCAAAAGG No data
906648502_906648511 27 Left 906648502 1:47493256-47493278 CCTGCAAGAATCCTTGACCTAAG No data
Right 906648511 1:47493306-47493328 TTTTCAGTGCCCTCCCCAAAAGG No data
906648500_906648511 29 Left 906648500 1:47493254-47493276 CCCCTGCAAGAATCCTTGACCTA No data
Right 906648511 1:47493306-47493328 TTTTCAGTGCCCTCCCCAAAAGG No data
906648507_906648511 10 Left 906648507 1:47493273-47493295 CCTAAGCTCCATGCAGGCAGGGA No data
Right 906648511 1:47493306-47493328 TTTTCAGTGCCCTCCCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906648511 Original CRISPR TTTTCAGTGCCCTCCCCAAA AGG Intergenic