ID: 906648513

View in Genome Browser
Species Human (GRCh38)
Location 1:47493308-47493330
Sequence TTCAGTGCCCTCCCCAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906648507_906648513 12 Left 906648507 1:47493273-47493295 CCTAAGCTCCATGCAGGCAGGGA No data
Right 906648513 1:47493308-47493330 TTCAGTGCCCTCCCCAAAAGGGG No data
906648508_906648513 4 Left 906648508 1:47493281-47493303 CCATGCAGGCAGGGACCAAGCCT No data
Right 906648513 1:47493308-47493330 TTCAGTGCCCTCCCCAAAAGGGG No data
906648501_906648513 30 Left 906648501 1:47493255-47493277 CCCTGCAAGAATCCTTGACCTAA No data
Right 906648513 1:47493308-47493330 TTCAGTGCCCTCCCCAAAAGGGG No data
906648503_906648513 18 Left 906648503 1:47493267-47493289 CCTTGACCTAAGCTCCATGCAGG No data
Right 906648513 1:47493308-47493330 TTCAGTGCCCTCCCCAAAAGGGG No data
906648502_906648513 29 Left 906648502 1:47493256-47493278 CCTGCAAGAATCCTTGACCTAAG No data
Right 906648513 1:47493308-47493330 TTCAGTGCCCTCCCCAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906648513 Original CRISPR TTCAGTGCCCTCCCCAAAAG GGG Intergenic