ID: 906650194

View in Genome Browser
Species Human (GRCh38)
Location 1:47507824-47507846
Sequence GGGGCCCCTCCCGCTCAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906650183_906650194 11 Left 906650183 1:47507790-47507812 CCTTCTTCAGAGTAGCTTTGCTC No data
Right 906650194 1:47507824-47507846 GGGGCCCCTCCCGCTCAGCGGGG No data
906650181_906650194 13 Left 906650181 1:47507788-47507810 CCCCTTCTTCAGAGTAGCTTTGC No data
Right 906650194 1:47507824-47507846 GGGGCCCCTCCCGCTCAGCGGGG No data
906650182_906650194 12 Left 906650182 1:47507789-47507811 CCCTTCTTCAGAGTAGCTTTGCT No data
Right 906650194 1:47507824-47507846 GGGGCCCCTCCCGCTCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906650194 Original CRISPR GGGGCCCCTCCCGCTCAGCG GGG Intergenic
No off target data available for this crispr