ID: 906650361

View in Genome Browser
Species Human (GRCh38)
Location 1:47508458-47508480
Sequence TGCCGGGCCTGCGGCCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906650361_906650365 -8 Left 906650361 1:47508458-47508480 CCGCCGCGGCCGCAGGCCCGGCA No data
Right 906650365 1:47508473-47508495 GCCCGGCACGGATTCCTTTCAGG No data
906650361_906650369 -1 Left 906650361 1:47508458-47508480 CCGCCGCGGCCGCAGGCCCGGCA No data
Right 906650369 1:47508480-47508502 ACGGATTCCTTTCAGGCAGAGGG No data
906650361_906650368 -2 Left 906650361 1:47508458-47508480 CCGCCGCGGCCGCAGGCCCGGCA No data
Right 906650368 1:47508479-47508501 CACGGATTCCTTTCAGGCAGAGG No data
906650361_906650370 0 Left 906650361 1:47508458-47508480 CCGCCGCGGCCGCAGGCCCGGCA No data
Right 906650370 1:47508481-47508503 CGGATTCCTTTCAGGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906650361 Original CRISPR TGCCGGGCCTGCGGCCGCGG CGG (reversed) Intergenic