ID: 906654773

View in Genome Browser
Species Human (GRCh38)
Location 1:47539991-47540013
Sequence CCACACATGGTGCAGCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906654768_906654773 25 Left 906654768 1:47539943-47539965 CCAGCCAGCAGACACCTTAGATC No data
Right 906654773 1:47539991-47540013 CCACACATGGTGCAGCAACCAGG No data
906654769_906654773 21 Left 906654769 1:47539947-47539969 CCAGCAGACACCTTAGATCATGA No data
Right 906654773 1:47539991-47540013 CCACACATGGTGCAGCAACCAGG No data
906654770_906654773 11 Left 906654770 1:47539957-47539979 CCTTAGATCATGAAGTGACAGCA No data
Right 906654773 1:47539991-47540013 CCACACATGGTGCAGCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906654773 Original CRISPR CCACACATGGTGCAGCAACC AGG Intergenic
No off target data available for this crispr