ID: 906656558

View in Genome Browser
Species Human (GRCh38)
Location 1:47552474-47552496
Sequence AGAGAGAAGCAGTATGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906656552_906656558 11 Left 906656552 1:47552440-47552462 CCAGCTGGGTTTGGTCACTGTGA No data
Right 906656558 1:47552474-47552496 AGAGAGAAGCAGTATGGGTCAGG No data
906656551_906656558 14 Left 906656551 1:47552437-47552459 CCTCCAGCTGGGTTTGGTCACTG No data
Right 906656558 1:47552474-47552496 AGAGAGAAGCAGTATGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906656558 Original CRISPR AGAGAGAAGCAGTATGGGTC AGG Intergenic
No off target data available for this crispr