ID: 906658038

View in Genome Browser
Species Human (GRCh38)
Location 1:47562932-47562954
Sequence GTCTGTTGGCTCCACCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906658035_906658038 13 Left 906658035 1:47562896-47562918 CCCAGTCAATTGCATATATTTAT No data
Right 906658038 1:47562932-47562954 GTCTGTTGGCTCCACCAGCCTGG No data
906658036_906658038 12 Left 906658036 1:47562897-47562919 CCAGTCAATTGCATATATTTATT No data
Right 906658038 1:47562932-47562954 GTCTGTTGGCTCCACCAGCCTGG No data
906658034_906658038 14 Left 906658034 1:47562895-47562917 CCCCAGTCAATTGCATATATTTA No data
Right 906658038 1:47562932-47562954 GTCTGTTGGCTCCACCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906658038 Original CRISPR GTCTGTTGGCTCCACCAGCC TGG Intergenic
No off target data available for this crispr