ID: 906659194

View in Genome Browser
Species Human (GRCh38)
Location 1:47570616-47570638
Sequence GTGAGGTACCTCTAGCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906659194_906659201 28 Left 906659194 1:47570616-47570638 CCTAACTGCTAGAGGTACCTCAC No data
Right 906659201 1:47570667-47570689 TTATCCTGCTTGGCGTCTGCTGG No data
906659194_906659198 0 Left 906659194 1:47570616-47570638 CCTAACTGCTAGAGGTACCTCAC No data
Right 906659198 1:47570639-47570661 ACACTGGGAGTTTCTCACCTTGG No data
906659194_906659200 18 Left 906659194 1:47570616-47570638 CCTAACTGCTAGAGGTACCTCAC No data
Right 906659200 1:47570657-47570679 CTTGGCTGCTTTATCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906659194 Original CRISPR GTGAGGTACCTCTAGCAGTT AGG (reversed) Intergenic
No off target data available for this crispr