ID: 906659197

View in Genome Browser
Species Human (GRCh38)
Location 1:47570633-47570655
Sequence TGAGAAACTCCCAGTGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906659197_906659203 30 Left 906659197 1:47570633-47570655 CCTCACACACTGGGAGTTTCTCA No data
Right 906659203 1:47570686-47570708 CTGGAAATACCTCCTATCTCAGG No data
906659197_906659201 11 Left 906659197 1:47570633-47570655 CCTCACACACTGGGAGTTTCTCA No data
Right 906659201 1:47570667-47570689 TTATCCTGCTTGGCGTCTGCTGG No data
906659197_906659200 1 Left 906659197 1:47570633-47570655 CCTCACACACTGGGAGTTTCTCA No data
Right 906659200 1:47570657-47570679 CTTGGCTGCTTTATCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906659197 Original CRISPR TGAGAAACTCCCAGTGTGTG AGG (reversed) Intergenic
No off target data available for this crispr