ID: 906659201

View in Genome Browser
Species Human (GRCh38)
Location 1:47570667-47570689
Sequence TTATCCTGCTTGGCGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906659197_906659201 11 Left 906659197 1:47570633-47570655 CCTCACACACTGGGAGTTTCTCA No data
Right 906659201 1:47570667-47570689 TTATCCTGCTTGGCGTCTGCTGG No data
906659194_906659201 28 Left 906659194 1:47570616-47570638 CCTAACTGCTAGAGGTACCTCAC No data
Right 906659201 1:47570667-47570689 TTATCCTGCTTGGCGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906659201 Original CRISPR TTATCCTGCTTGGCGTCTGC TGG Intergenic
No off target data available for this crispr