ID: 906661708 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:47587567-47587589 |
Sequence | GTCACCATAGAAGCCCCTCC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
906661708_906661713 | 18 | Left | 906661708 | 1:47587567-47587589 | CCTGGAGGGGCTTCTATGGTGAC | No data | ||
Right | 906661713 | 1:47587608-47587630 | TACCTTGGGAATGGTTACAAAGG | No data | ||||
906661708_906661711 | 4 | Left | 906661708 | 1:47587567-47587589 | CCTGGAGGGGCTTCTATGGTGAC | No data | ||
Right | 906661711 | 1:47587594-47587616 | ACAGCTTTATTTCTTACCTTGGG | No data | ||||
906661708_906661710 | 3 | Left | 906661708 | 1:47587567-47587589 | CCTGGAGGGGCTTCTATGGTGAC | No data | ||
Right | 906661710 | 1:47587593-47587615 | CACAGCTTTATTTCTTACCTTGG | No data | ||||
906661708_906661712 | 9 | Left | 906661708 | 1:47587567-47587589 | CCTGGAGGGGCTTCTATGGTGAC | No data | ||
Right | 906661712 | 1:47587599-47587621 | TTTATTTCTTACCTTGGGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
906661708 | Original CRISPR | GTCACCATAGAAGCCCCTCC AGG (reversed) | Intergenic | ||