ID: 906661708

View in Genome Browser
Species Human (GRCh38)
Location 1:47587567-47587589
Sequence GTCACCATAGAAGCCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906661708_906661713 18 Left 906661708 1:47587567-47587589 CCTGGAGGGGCTTCTATGGTGAC No data
Right 906661713 1:47587608-47587630 TACCTTGGGAATGGTTACAAAGG No data
906661708_906661711 4 Left 906661708 1:47587567-47587589 CCTGGAGGGGCTTCTATGGTGAC No data
Right 906661711 1:47587594-47587616 ACAGCTTTATTTCTTACCTTGGG No data
906661708_906661710 3 Left 906661708 1:47587567-47587589 CCTGGAGGGGCTTCTATGGTGAC No data
Right 906661710 1:47587593-47587615 CACAGCTTTATTTCTTACCTTGG No data
906661708_906661712 9 Left 906661708 1:47587567-47587589 CCTGGAGGGGCTTCTATGGTGAC No data
Right 906661712 1:47587599-47587621 TTTATTTCTTACCTTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906661708 Original CRISPR GTCACCATAGAAGCCCCTCC AGG (reversed) Intergenic