ID: 906662040

View in Genome Browser
Species Human (GRCh38)
Location 1:47589908-47589930
Sequence TGCCCCCCATTTCACATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906662040_906662044 0 Left 906662040 1:47589908-47589930 CCTGGTATGTGAAATGGGGGGCA No data
Right 906662044 1:47589931-47589953 GGGCTGGCATTTACTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906662040 Original CRISPR TGCCCCCCATTTCACATACC AGG (reversed) Intergenic
No off target data available for this crispr