ID: 906662529

View in Genome Browser
Species Human (GRCh38)
Location 1:47593223-47593245
Sequence CGCTGCAGACCCTGCGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906662529_906662543 25 Left 906662529 1:47593223-47593245 CCGTCTCCGCAGGGTCTGCAGCG No data
Right 906662543 1:47593271-47593293 GGCCCGCCGCCGCCAGCCCGGGG No data
906662529_906662542 24 Left 906662529 1:47593223-47593245 CCGTCTCCGCAGGGTCTGCAGCG No data
Right 906662542 1:47593270-47593292 CGGCCCGCCGCCGCCAGCCCGGG No data
906662529_906662541 23 Left 906662529 1:47593223-47593245 CCGTCTCCGCAGGGTCTGCAGCG No data
Right 906662541 1:47593269-47593291 GCGGCCCGCCGCCGCCAGCCCGG No data
906662529_906662535 4 Left 906662529 1:47593223-47593245 CCGTCTCCGCAGGGTCTGCAGCG No data
Right 906662535 1:47593250-47593272 GGCCCGCACCTCCTGCTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906662529 Original CRISPR CGCTGCAGACCCTGCGGAGA CGG (reversed) Intergenic
No off target data available for this crispr