ID: 906663115

View in Genome Browser
Species Human (GRCh38)
Location 1:47596550-47596572
Sequence GCCTGGGGTATGGGATGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906663106_906663115 1 Left 906663106 1:47596526-47596548 CCAGAAGAGACACAGAGAAGCCA No data
Right 906663115 1:47596550-47596572 GCCTGGGGTATGGGATGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906663115 Original CRISPR GCCTGGGGTATGGGATGGTC AGG Intergenic
No off target data available for this crispr