ID: 906666288

View in Genome Browser
Species Human (GRCh38)
Location 1:47624418-47624440
Sequence AACCTCATGCTGGAACTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906666288_906666291 1 Left 906666288 1:47624418-47624440 CCTCTGAGTTCCAGCATGAGGTT No data
Right 906666291 1:47624442-47624464 GTTTAAGTCTCTCTTGGTACTGG No data
906666288_906666290 -5 Left 906666288 1:47624418-47624440 CCTCTGAGTTCCAGCATGAGGTT No data
Right 906666290 1:47624436-47624458 AGGTTTGTTTAAGTCTCTCTTGG No data
906666288_906666295 21 Left 906666288 1:47624418-47624440 CCTCTGAGTTCCAGCATGAGGTT No data
Right 906666295 1:47624462-47624484 TGGGGAATCTCATGTGCCATGGG No data
906666288_906666294 20 Left 906666288 1:47624418-47624440 CCTCTGAGTTCCAGCATGAGGTT No data
Right 906666294 1:47624461-47624483 CTGGGGAATCTCATGTGCCATGG No data
906666288_906666293 3 Left 906666288 1:47624418-47624440 CCTCTGAGTTCCAGCATGAGGTT No data
Right 906666293 1:47624444-47624466 TTAAGTCTCTCTTGGTACTGGGG No data
906666288_906666292 2 Left 906666288 1:47624418-47624440 CCTCTGAGTTCCAGCATGAGGTT No data
Right 906666292 1:47624443-47624465 TTTAAGTCTCTCTTGGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906666288 Original CRISPR AACCTCATGCTGGAACTCAG AGG (reversed) Intergenic
No off target data available for this crispr