ID: 906667205

View in Genome Browser
Species Human (GRCh38)
Location 1:47630416-47630438
Sequence TCACTGCCATGCTGTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906667198_906667205 13 Left 906667198 1:47630380-47630402 CCAAAATGGCACAGATTGGGAGG No data
Right 906667205 1:47630416-47630438 TCACTGCCATGCTGTCCTGCAGG No data
906667195_906667205 22 Left 906667195 1:47630371-47630393 CCAGAAGCACCAAAATGGCACAG No data
Right 906667205 1:47630416-47630438 TCACTGCCATGCTGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906667205 Original CRISPR TCACTGCCATGCTGTCCTGC AGG Intergenic