ID: 906671977

View in Genome Browser
Species Human (GRCh38)
Location 1:47662713-47662735
Sequence CAGGGTAGGCAGAGTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906671977_906671982 2 Left 906671977 1:47662713-47662735 CCAGCCTCACTCTGCCTACCCTG No data
Right 906671982 1:47662738-47662760 TGCTGTCCCACCTATGTTACAGG No data
906671977_906671983 3 Left 906671977 1:47662713-47662735 CCAGCCTCACTCTGCCTACCCTG No data
Right 906671983 1:47662739-47662761 GCTGTCCCACCTATGTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906671977 Original CRISPR CAGGGTAGGCAGAGTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr