ID: 906672049

View in Genome Browser
Species Human (GRCh38)
Location 1:47663280-47663302
Sequence GGCAAATGGACTTCATCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906672049_906672056 29 Left 906672049 1:47663280-47663302 CCTTTAGATGAAGTCCATTTGCC No data
Right 906672056 1:47663332-47663354 AGTTTCACATATTTACTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906672049 Original CRISPR GGCAAATGGACTTCATCTAA AGG (reversed) Intergenic
No off target data available for this crispr