ID: 906672136

View in Genome Browser
Species Human (GRCh38)
Location 1:47664120-47664142
Sequence TTTCAAAACCAGAGGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906672136_906672139 3 Left 906672136 1:47664120-47664142 CCTATCTCCCTCTGGTTTTGAAA No data
Right 906672139 1:47664146-47664168 CTTCAATAGACTCTTCTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906672136 Original CRISPR TTTCAAAACCAGAGGGAGAT AGG (reversed) Intergenic
No off target data available for this crispr