ID: 906676418

View in Genome Browser
Species Human (GRCh38)
Location 1:47696868-47696890
Sequence TTTTCCAACCATGAGTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906676418_906676419 0 Left 906676418 1:47696868-47696890 CCTCATTACTCATGGTTGGAAAA No data
Right 906676419 1:47696891-47696913 CAATGTTAATTTCCCCCAAGCGG No data
906676418_906676425 25 Left 906676418 1:47696868-47696890 CCTCATTACTCATGGTTGGAAAA No data
Right 906676425 1:47696916-47696938 AGCAGCTGCACTTGTGAGCCAGG No data
906676418_906676426 26 Left 906676418 1:47696868-47696890 CCTCATTACTCATGGTTGGAAAA No data
Right 906676426 1:47696917-47696939 GCAGCTGCACTTGTGAGCCAGGG No data
906676418_906676420 1 Left 906676418 1:47696868-47696890 CCTCATTACTCATGGTTGGAAAA No data
Right 906676420 1:47696892-47696914 AATGTTAATTTCCCCCAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906676418 Original CRISPR TTTTCCAACCATGAGTAATG AGG (reversed) Intergenic
No off target data available for this crispr