ID: 906677792

View in Genome Browser
Species Human (GRCh38)
Location 1:47705774-47705796
Sequence GGGGAAAAAATTGCCTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906677792_906677796 -4 Left 906677792 1:47705774-47705796 CCAACACAGGCAATTTTTTCCCC No data
Right 906677796 1:47705793-47705815 CCCCAGGGTAGCTAATTAGCAGG No data
906677792_906677799 7 Left 906677792 1:47705774-47705796 CCAACACAGGCAATTTTTTCCCC No data
Right 906677799 1:47705804-47705826 CTAATTAGCAGGCAGCTGCACGG No data
906677792_906677800 8 Left 906677792 1:47705774-47705796 CCAACACAGGCAATTTTTTCCCC No data
Right 906677800 1:47705805-47705827 TAATTAGCAGGCAGCTGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906677792 Original CRISPR GGGGAAAAAATTGCCTGTGT TGG (reversed) Intergenic
No off target data available for this crispr