ID: 906677796

View in Genome Browser
Species Human (GRCh38)
Location 1:47705793-47705815
Sequence CCCCAGGGTAGCTAATTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906677788_906677796 27 Left 906677788 1:47705743-47705765 CCCGCGGAAACAGGCAAACACAT No data
Right 906677796 1:47705793-47705815 CCCCAGGGTAGCTAATTAGCAGG No data
906677789_906677796 26 Left 906677789 1:47705744-47705766 CCGCGGAAACAGGCAAACACATT No data
Right 906677796 1:47705793-47705815 CCCCAGGGTAGCTAATTAGCAGG No data
906677792_906677796 -4 Left 906677792 1:47705774-47705796 CCAACACAGGCAATTTTTTCCCC No data
Right 906677796 1:47705793-47705815 CCCCAGGGTAGCTAATTAGCAGG No data
906677791_906677796 1 Left 906677791 1:47705769-47705791 CCACTCCAACACAGGCAATTTTT No data
Right 906677796 1:47705793-47705815 CCCCAGGGTAGCTAATTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906677796 Original CRISPR CCCCAGGGTAGCTAATTAGC AGG Intergenic
No off target data available for this crispr