ID: 906677800

View in Genome Browser
Species Human (GRCh38)
Location 1:47705805-47705827
Sequence TAATTAGCAGGCAGCTGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906677792_906677800 8 Left 906677792 1:47705774-47705796 CCAACACAGGCAATTTTTTCCCC No data
Right 906677800 1:47705805-47705827 TAATTAGCAGGCAGCTGCACGGG No data
906677791_906677800 13 Left 906677791 1:47705769-47705791 CCACTCCAACACAGGCAATTTTT No data
Right 906677800 1:47705805-47705827 TAATTAGCAGGCAGCTGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906677800 Original CRISPR TAATTAGCAGGCAGCTGCAC GGG Intergenic
No off target data available for this crispr