ID: 906678349

View in Genome Browser
Species Human (GRCh38)
Location 1:47709018-47709040
Sequence TGGCAGGGCCAGGCTCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678349_906678353 -8 Left 906678349 1:47709018-47709040 CCTTTCAGAGCCTGGCCCTGCCA No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678349_906678357 0 Left 906678349 1:47709018-47709040 CCTTTCAGAGCCTGGCCCTGCCA No data
Right 906678357 1:47709041-47709063 CCTGTAGAAGGAAGGCGCGCTGG No data
906678349_906678358 3 Left 906678349 1:47709018-47709040 CCTTTCAGAGCCTGGCCCTGCCA No data
Right 906678358 1:47709044-47709066 GTAGAAGGAAGGCGCGCTGGTGG No data
906678349_906678360 23 Left 906678349 1:47709018-47709040 CCTTTCAGAGCCTGGCCCTGCCA No data
Right 906678360 1:47709064-47709086 TGGCCCGTTCAAGCAGGCAGTGG No data
906678349_906678359 17 Left 906678349 1:47709018-47709040 CCTTTCAGAGCCTGGCCCTGCCA No data
Right 906678359 1:47709058-47709080 CGCTGGTGGCCCGTTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678349 Original CRISPR TGGCAGGGCCAGGCTCTGAA AGG (reversed) Intergenic
No off target data available for this crispr