ID: 906678353

View in Genome Browser
Species Human (GRCh38)
Location 1:47709033-47709055
Sequence CCCTGCCACCTGTAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678341_906678353 26 Left 906678341 1:47708984-47709006 CCGCCTGCTGCGGCTCCCGGGGC No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678343_906678353 11 Left 906678343 1:47708999-47709021 CCCGGGGCCAGCGCCCTAACCTT No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678339_906678353 27 Left 906678339 1:47708983-47709005 CCCGCCTGCTGCGGCTCCCGGGG No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678345_906678353 4 Left 906678345 1:47709006-47709028 CCAGCGCCCTAACCTTTCAGAGC No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678348_906678353 -3 Left 906678348 1:47709013-47709035 CCTAACCTTTCAGAGCCTGGCCC No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678337_906678353 28 Left 906678337 1:47708982-47709004 CCCCGCCTGCTGCGGCTCCCGGG No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678344_906678353 10 Left 906678344 1:47709000-47709022 CCGGGGCCAGCGCCCTAACCTTT No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678335_906678353 29 Left 906678335 1:47708981-47709003 CCCCCGCCTGCTGCGGCTCCCGG No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678334_906678353 30 Left 906678334 1:47708980-47709002 CCCCCCGCCTGCTGCGGCTCCCG No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678349_906678353 -8 Left 906678349 1:47709018-47709040 CCTTTCAGAGCCTGGCCCTGCCA No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678342_906678353 23 Left 906678342 1:47708987-47709009 CCTGCTGCGGCTCCCGGGGCCAG No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
906678347_906678353 -2 Left 906678347 1:47709012-47709034 CCCTAACCTTTCAGAGCCTGGCC No data
Right 906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678353 Original CRISPR CCCTGCCACCTGTAGAAGGA AGG Intergenic
No off target data available for this crispr